CompCytogen 9(1): I-15 (2015) COMPARATIVE = Aveerrsrewet open-access oven doi: 10.3897/CompCytogen.v9i |.873 Kan Cyto genetics http://compcytogen.pensoft.net International journal of Plant & Animal Cytogenetics, Karyosystematics, and Molecular Systematics Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish Chionodraco hamatus (Notothenioidei, Channichthyidae) Ennio Cocca', Agnese Petraccioli?, Maria Alessandra Morescalchi’, Gaetano Odierna’, Teresa Capriglione’ I Istituto di Bioscienze e Biorisorse, CNR, via P Castellino 111, 80131 Napoli, Italy 2 Dipartimento di Biologia, Universita di Napoli Federico II, Complesso Universitario Monte S. Angelo, via Cinthia, 80126 Napoli, Italy Corresponding author: Teresa Capriglione (teresa.capriglione@unina.it) Academic editor: NV. Shapoval | Received 10 October 2014 | Accepted 9 December 2014 | Published 5 February 2015 http:/zoobank. org/9ECEEA88-A980-4C49-BAC9-3A79F69E804D Citation: Cocca E, Petraccioli A, Morescalchi MA, Odierna G, Capriglione T (2015) Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish Chionodraco hamatus (Notothenioidei, Channichthyidae). Comparative Cytogenetics 9(1): 1-15. doi: 10.3897/CompCytogen.v9i1.8731 Abstract Microdissection, DOP-PCR amplification and microcloning were used to study the large Y chromosome of Chionodraco hamatus, an Antarctic fish belonging to the Notothenioidei, the dominant component of the Southern Ocean fauna. The species has evolved a multiple sex chromosome system with digametic males showing an X1YX2 karyotype and females an X1X1X2X2 karyotype. Fluorescence in situ hybridi- zation, performed with a painting probe made from microdissected Y chromosomes, allowed a deeper insight on the chromosomal rearrangement, which underpinned the fusion event that generated the Y. Then, we used a DNA library established by microdissection and microcloning of the whole Y chromo- some of Ch. hamatus for searching sex-linked sequences. One clone provided preliminary information on the presence on the Y chromosome of the CHD1 gene homologue, which is sex-linked in birds but in no other vertebrates. Several clones from the Y-chromosome mini-library contained microsatellites and transposable elements, one of which mapped to the q arm putative fusion region of the Y chromosome. The findings confirm that interspersed repetitive sequences might have fostered chromosome rearrange- ments and the emergence of the Y chromosome in Ch. hamatus. Detection of the CHD1 gene in the Y sex-determining region could be a classical example of convergent evolution in action. Keywords Sex chromosomes, Antarctic fish, CHD 1 gene Copyright Ennio Cocca et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 2 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Introduction The chromosome microdissection and microcloning technique (Almeida-Toledo et al. 2000) can be used for a number of applications, including generation of chromosome painting probes and construction of genetic linkage as well as physical maps. First applied to Drosophila melanogaster (Meigen, 1830) polytene chromosomes and later employed to obtain whole or partial human chromosome paints (Jauch et al. 1992, Stanyon et al. 1995, Bigoni et al. 1997, Morescalchi et al. 1997, Yang et al. 2006), chromosome microdissection is considered a suitable bridge between cytogenetics and molecular genetics (Zhou and Hu 2007). Chromosome microdissection has recently been applied to lower vertebrates to generate painting probes for phylogenetic studies (Diniz et al. 2008, Giovannotti et al. 2009, Machado et al. 2011, Pokorné et al. 2011, Trifonov et al. 2011, Kawagoshi et al. 2012). In cold-blooded vertebrates its applica- tion may be hampered by difficulties in identifying the chromosomes clearly in the karyotype of the species, where the heteromorphic sex chromosome is often the one most easily recognizable (Almeida-Toledo et al. 2000, Odierna et al. 2004, Kuprija- nova et al. 2005, Cioffi et al. 2012). Sex chromosomes have originated independently many times in both animals and plants from ordinary autosomes (Arnemann et al. 1986, Almeida-Toledo et al. 2000). ‘Their evolution is characterized by a loss of gene function on the non-recombining Y chromosome, as seen in many taxa (Badenhorst et al. 2012, Bohne et al. 2014). While sex-determining genes have been identified and mapped on the heteromor- phic sex chromosomes of mammals and birds (Handley et al. 2004, Lahn and Page 2004), data on their linkage and localization in cold-blooded vertebrates are only just beginning to be reported. Fish sex chromosomes often appear undifferentiated, sharing a similar morphol- ogy and a comparable gene composition (Charlesworth 2004, Charlesworth et al. 2005). The sex-determining region (SDR) has been identified in several teleost species (Geschwend et al. 2012, Liew et al. 2012) and the first likely sex-determining gene was found in medaka, Oryzias latipes (Temminck & Schlegel, 1846), in which a copy of the Dmrtl gene, DmY, maps on the putative Y sex chromosome. Some correspond- ence has been found, in other fish as well as for the congeneric species (Matsuda 2005, Kondo et al. 2009), while novel candidates, all coding for members of the TGF-beta signalling pathway, have recently been identified in different teleostean species (Ki- kuchi and Hamaguchi 2013, Bohne et al. 2014). Some fishes present multiple sex-chromosome systems, in which the initial stage of differentiation seems to be independent of heterochromatin accumulation in chro- mosomes and to be related to chromosome rearrangement, whereas simple sex-chro- mosome systems show progressive heterochromatin accumulation (Almeida-Toledo et al. 2000, Cioffi et al. 2012). The variety of sex-chromosome systems and the broad range of sex-determination mechanisms typical of fishes make it an interesting group in which to explore sex- chromosome evolution. ‘The present study was designed to seek correlations between Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 3 cytologically recognizable fish X and Y chromosomes and to establish whether they are related to different genetic make-up or simply to fusion events, perhaps trigged by differential amplification of repetitive DNA fractions. To shed light on the genome composition of a teleost sex chromosome, laser microdissection and pressure catapulting (LMPC) was used to isolate the Y chromosome from standard mitotic plates of the Antarctic icefish Chionodraco hamatus (Lonnberg, 1905) belonging to the Notothenioidei, the dominant endemic component of the Southern Ocean fauna. The physiological and molecular adaptations that have enabled their evolution have made this Antarctic clade unique among vertebrates. The karyotype of most Notothenioidei shows 2n = 48 mostly acrocentric chromosomes, which is considered basic for Perciformes, and nucleolus organizer regions (NORs) localized on the telomeres of a single chromosome pair (Morescalchi et al. 1996, Pisano and Ghigliotti 2009). Heteromorphic sex chromosomes have been found in species belonging to three notothenioid families (Morescalchi et al. 1992, Caputo et al. 2002). In such species males have a large Y chromosome, resulting from a centric or tandem fusion event, and a consequent decrease in chromosome number to 2n = 47. This feature is shared by Ch. hamatus, the model selected for this study. Ch. hamatus females have 2n=48 chromosomes with a small metacentric pair, a submetacentric pair, 20 acrocentric pairs and a X,X,X,X,, multiple sex chromosome system, where X, is submetacentric and X, is acrocentric; males of Ch. hamatus present 2n=47 with the same basal chromosome set plus the X1X2Y sex chromosome system, where the Y is the largest submetacentric element, likely, derived from X1-X2 tandem fusion (Morescalchi et al. 1992). Ch. hamatus Y chromosomes were isolated and amplified by degenerate oligonu- cleotide primed PCR (DOP-PCR) as described by Telenius et al. (1992). The DNA fragments generated were (i) labelled with biotin, hybridized in situ to metaphase spreads, and (ii) used to construct a Y-chromosome mini-library that was subsequently screened for Y-chromosome DNA sequences. Methods Y chromosome microdissection Ch. hamatus specimens were collected near Mario Zucchelli Station, on the coast of Terra Nova Bay (74°42'S, 164°07'E), during Italian Antarctic expeditions in 2000 and 2005. They were killed by severing the spinal cord according to animal welfare guidelines. Mitotic chromosome plates were prepared from a Ch. hamatus male as described in Morescalchi et al. (1992). The chromosome suspension was dropped onto slides covered with a polyethylene naphthalate membrane, and Y chromosomes were micro- dissected using a PALM MicroBeam system (Carl Zeiss, Italy, http://www.zeiss.it/). All procedures were as described by Schermelleh et al. 1999. 4 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Y chromosomes (20/slide) were outlined and excised using a low-energy laser beam and catapulted by a single laser pulse directly into the cap of an Eppendorf tube, to minimize contamination. DOP-PCR DOP-PCR reactions were carried out without chromosome pre-treatment (Telenius et al. 1992). The DOP primer sequence 5°--CCGACTCGAGNNNNNNATGTGG-3' was used to conduct a PCR reaction with 1 x ThermoSequenase reaction buffer, 40 uM dNTPs, 2 uM DOP primer, and 10 U ThermoSequenase enzyme. The first amplification was carried out by RAMP-PCR: 94 °C for 5 min; 12 cycles at low stringency (94 °C for 90 s, 32 °C for 2 min, increasing by 0.2 °C/s to 72 °C, then 72 °C for 2 min), followed by 35 cycles at high stringency (94 °C for 90 s, 52 °C for 90 s and 72 °C for 90s). 10 pl of the DOP-PCR product was run on 1% agarose gel. Fluorescence Jn Situ Hybridization (FISH) FISH with the Y probe The species specificity of the probe was checked by dot-blot hybridization under strin- gent conditions using digoxigenin-labelled Y chromosome material as a probe on hu- man and fish total genomic DNA spotted on a nitrocellulose membrane. Dot-blot analysis confirmed the absence of contamination, showing a strong hybridization sig- nal only to Ch. hamatus genomic DNA (data not shown). The DOP-PCR-amplified chromosome material was re-amplified and labelled with 16-dUTP-biotin (Roche). The PCR mix comprised 1 x Tag polymerase buffer (2 mM MgCl), 40 uM dATP, dGTP and dCTP, 28 uM dTTP, 12 uM 16-dUTP biotin, 2 uM DOP primer, and 0.05 U/ul Tag polymerase under the following con- ditions: (1x) 94 °C for 5 min; (35x) 90 °C for 1 min and 30 s, 52 °C for 1 min and 30 s, 72 °C for 1 min and 30 s, and (1x) 72 °C for 5 min. The FISH procedure was performed under high stringency conditions (50% formamide, 2 x SSC, 10% dex- tran sulphate). Metaphase spreads for FISH were prepared on ethanol-cleaned slides, air-dried and incubated overnight at 37 °C. Chromosomes were denatured in 70% deionized formamide 2 x SSC at 72 °C for 7 min and dehydrated in an ethanol series. A DNA mixture of approximately 400 ng of the chromosome painting probe and 10 pg of the Cot-1 fraction of Ch. hamatus (Yan et al. 2010) was prepared, ethanol precipitated, vacuum dried, and dissolved in 10 ul of hybridization mixture containing 50% deionized formamide, 10% dextran sulphate, and 2 x SSC. After denaturation (10 min at 75 °C) the probe was dropped onto a slide and spread over the hybridiza- tion area using a 22 x 22 mm glass coverslip. The edges of the coverslip were sealed with rubber cement and slides were incubated for 3 days at 37 °C in a humid chamber. Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 5 Post-hybridization washes were in 0.4 x SSC/0.1% Triton X-100 for 5 min at 42 °C and in 2 x SSC/0.1% Triton X-100 for 15 min at room temperature. Signal detec- tion was accomplished using AlexaFluor-Streptavidin 488 (Molecular Probes) accord- ing to Cocca et al. (2011). Chromosomes were counterstained with propidium iodide in Vectashield mounting medium (Vector), analysed using a fluorescence microscope (Zeiss Axioskop) equipped with a CCD camera (Hamamatsu Chilled), and processed with the Isis FISH imaging system (v. 3.04, Metasystems). Mini-library construction DOP-PCR fragments were purified with the NucleoSpin Extract II Kit (Macherey- Nagel). Three ul aliquots were cloned into the TOPO TA Cloning Kit (Invitrogen Life Technologies). Transformation and clone analysis were conducted according to the manufacturer's instructions. Recombinant clones were isolated and PCR amplification was used to establish insert presence and size. Sequencing was performed by Primm Biotech (Milano, Italy). The nucleotide sequences, ranging from 200 to 800 bp, were used for homology searches in four databases (National Center for Biotechnology In- formation, NCBI: http://www.ncbi.nlm.nih.gov; DNA DataBank of Japan, DDBJ: http://www.ddbj.nig.ac.jp; Nucleotide EST Database; and RepBase: http://www. girinst.org/repbase) using BLAST (Basic Local Alignment Search Tool, http://blast. ncbi.nlm.nih.gov), FASTA (http://www.ebi.ac.uk/Tools/sss/fasta), and RepeatMasker (http://www.repeatmasker.org) sequence alignment programs. Results The results of FISH, performed on metaphase plates of Ch. hamatus males and females using the newly generated Y-chromosome paint, are shown in Fig. 1. In males (Fig. 1a) a strong hybridization signal was detected along the Y chromosome. On other chro- mosomes the signal was faint up to the subtelomeric regions. A single medium-sized acrocentric chromosome showed a clear pericentromeric signal. On female metaphase plates (Fig.1b), the hybridization signal was intense and confined to the pericentro- meric and interstitial regions of two medium-sized acrocentrics. Thirty sequences were recovered by cloning with clear information obtained only for four of them. The identification of syntenic regions may have been hampered by sequence length and by the lack of whole sequenced genomes of Antarctic fishes. Most clones were found to contain redundant repetitive sequences; moreover, several clones did not show significant homologies to any genomic or translated sequence contained in the GenBank database, suggesting that they may correspond to untranslated or non-con- served regions of genes already known from other species. FASTX analysis of clone C11 (251 bp) against library ‘B170.0 vertebrates’ yielded the highest similarity score for fish genome fragments. Interestingly, its uninterrupt- Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Figure |. Mitotic chromosomes of Ch. hamatus. FISH with the Y chromosome paint on Ch. hamatus a male (2n = 47 and X1X2Y sex-chromosome system) and b female (2n = 48) metaphase spreads. C. hamatus C11 D. rerio T. nigroviridis G. aculeatus Consensus 100% Conservation sue Sequence logo C. hamatus C11 D. rerio T. nigroviridis G. aculeatus Consensus 100% Conservation O% 4,208 Sequence logo 0.065 AMHERPMOED cHOBKPMOED cHOBRPHOED GIQLRPYQLD © Sl BLEPYQLD PTSMMGNWGK PHAMBENWRO PESMBENWRE PESMMENWRE PLSVLENWRK cURWESECME cMQWESRCEH cMowalTaclkK GVQWLSXCXK el sn EBEKEAPSEK EBERECPSES EE -SMaAPSEK EBESBAPSET ELESFAPSLK Au NGGcCREcCBE KGaccCHEcCBE NOGccCHEGBE NQQGCILGDE 0et ANE URBHRCSORE MECHTCBDKEK MEUMKCDKAR MECKKCDKER VLCYKGDKEX ! B EcickT¥aml 60 I TREBMUKEHE KPKMPABMMC 33 SHBAWARGSE KMNGPEBMEC co M SHBBMESGCAB GNNGPEBMES co MGHcKTCQTM SBBMEMScAP GRKGPRBMES co MGLGKTCQTI SLLLYVSGAL KXXGPFLVLX 1 TT tiftcteeien oof bliin WOLGKTEQe! StCeFostxe enPPLiLs KBDEBRTBAE B--MORURTT ---- RAEBOONEKS DPREHMBETT HEWCHRDARM 120 RAEBQKEENS HE-EHMMETT HEBCHRBASE 113 RABBHRETGT GD-EOMEETT HEBCHKDASE 119 RAELQRELXS DX-FXVXLTT YELCLKDASF 40 McEcKTCcoTl McGEcKTCoSH Figure 2. Alignment of the N-terminal portion of a Chromodomain-helicase-DNA-binding protein 1-like (CHD1) with the homologous CHD1 sequences of fish: Danio rerio, Tetraodon nigroviridis, and Gasterosteus aculeatus. G. aculeatus CEC26-G09 S. platorynchus microsatellite C. hamatus CHS4 P. altivelis microsatellite Consensus 1 Conservation Sequence logo 0% 2,0bits 0,0bits G. aculeatus CEC26-G09 S. platorynchus microsatellite HEAGEHBAABA BEGG C. hamatus CHS4 E. burgeri Sox9 MRNA P. altivelis microsatellite Consensus 100% Conservation Sequence logo Ge 001s TCACTCAACA CGGGAAGA G i i pemmrl) sertéafSt 7 ER ATATCTGCAG AANTCCCC-- 0% 2,0bits AAAATCACATC 120 l ABBACGHEAG co ERGEEHS 119 5. 1 |) GEBTIGERAG 6: GNCCTGCTAG annecAgT - -SNNGTAAG --CTNCTNNG AS AAREEGCES- - all I feo |e fifi RT x TerGCae heafS8eber eabln faz GeCe-60-A6 Figure 3. Repetitive sequence of clone CHS4 aligned with several loci of Plecoglossus altivelis, Gasterosteus acu- leatus, Scaphirhynchus platorynchus and Eptatretus burgeri. Notably, in E. burgeri the sequence is found in Sox9. Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 7 2 ” i) 80 100 1 1 1 ! 1 C. hamatus C3 AAAAACAAAACCCCCACCCCCCCCCCCCCCCCCCCCCGGCAAGAT TATTAAATTTTATACACGCCCCCCCTCCCGCAT AAAAGGAAGAAGAGTGT AACAAAAAATATATA 120 140 Wo 180 200 220 i] 1 1 i] ! Cc. hamatus C3 TGAGTTCGCTTACTATTAAT TCCCCCCGCCTGACCCTT TACACCCCCCCCTCGGTCCCCCCTACAACAAAGACGGGCAACTCACCCTCCCCCCGGAAGTTTTATTCCGCT microsatellite C. hamatus C3. CTGGGGGNTTTTATT TTGGTGATCTATAGAATACTCAAGTATGCATCAAGCT TGGGACCGAGC T CGGAGAGC TAG TAGCACCGCCAGTGTGCTGGAATTGGCCCT CCGA LA/CINS 1 —————— _ — ee ee ——$—_ ae C. hamatus C3. CTCGAGGCCTGCATGTGGCAATGAGAAGACTGTATATTCTCTTTT TGGGTGAAGAGT TCTGTATATATCAGATCCACTTGAT TCAGAGCCGAGTTCAGGTTCTGAATATA LACING microsatellite % Cc. hamatus C3. TTTGTTAATTTTTTGTTTCAATGATCTGTCTAAAATAGTCAGTGGGGTGT TAAAGTCT TCCACATCGTTGGC t CGAGTCGGAAGGGCGAAT TCTGCAGATATCCATCACA microsatellite “ 640 Co) 1 1 C, hamatus C3. CTGGCGGCGCTCGCGCGTGCATCT TGAGGGCCCAAT TCGTCCTATAGTGAGTCGTATAAAAAAAGGTGCAACACGGTAAAAAAAAATCGCGGGT GGGGGAGAAGGGTGGT 680 70) 740 1 1 1 t 1 C. hamatus C3. TGTGGT TT TT TACTACATCACATAGGAGCAGGTT TCGTTGT TTACGTGAGAGGGGTGGGGTAGTCT TGTTATGGT TTGTCCCACGCACCGCTCTTACTTATTGTGGTTGC 780 0 820 ! 1 1 C, hamatus C3. TCTGCTCACCCAGTGTTTT TATGGAAGTGGACACCCTGTTGTGTGGCCAGTTAAA Figure 4. Structure of clone C3: the partial LINE (position 341-504 bp) is bordered by microsatellite regions both upstream (232-325 bp) and downstream (520-640 bp). Figure 5. Jn situ hybridization of the C3 probe (CIN1/L4) to the Ch. hamatus male karyotype: the probe clearly maps interstitially on the q arm of the Y chromosome. Insert: a C-banded and chromomycin- stained Y chromosome of Ch. hamatus and b FISH performed using the Tcl-like DNA transposon as probe (modified from fig. 5 of Capriglione et al. 2002) compared to ¢ C3 hybridized Y chromosome. ed amino acid translation was found to be homologous to an N-terminal portion of a Chromodomain-helicase-DNA-binding protein 1-like (CHD1) (The European nucleotide archive: at http://www.ebi.ac.uk/ena/data/view/LM999957), a conserved protein with a putative role in chromatin architecture (Fig. 2). RepeatMasker analysis allowed identification in clone CHS4 of a microsatellite strand whose sequence is conserved in other teleost species. FASTA and BLAST analysis 8 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) showed that our sequence aligned with several loci in the genome of Plecoglossus altivelis (Temminck & Schlegel, 1846), Gasterosteus aculeatus (Linnaeus, 1758), Scaphirhynchus platorynchus (Rafinesque, 1820), and Eptatretus burgeri (Girard, 1855). Notably, in E£. burgeri the sequence is found in Sox? mRNA for Sry-box protein 9 (Ota et al. 2007) (Fig. 3). Moreover, a similar sequence is found in the ATP-binding cassette of Tremato- mus newnesi (Boulenger, 1902), another notothenioid species. In two other clones, C3 (825 bp) and C5 (244 bp), putative ancient LINE (Long Interspersed Element) fragments (non-LTR retrotransposon of the L1/CIN4 family) were found. In clone C3 the partial LINE (position 342—503 bp) is bordered by repetitive regions both upstream (232-327 bp) and downstream (521-639 bp) (Fig. 4). FISH disclosed that the clone clearly mapped interstitially on the q arm of the Y chromosome (Fig. 5). Discussion Chromosome microdissection provides valuable chromosome information on lower vertebrate, fish, amphibian, and reptilian genomes, in which chromosome identifica- tion is hampered by difficulties in obtaining specific chromosome markers, and detec- tion of syntenic regions is prevented by the lack of sequenced genomes. Ch. hamatus Y-chromosome paint hybridized strongly to a single acrocentric chro- mosome pair, perhaps X2X2, in the female karyotype. ‘The signal localization on the pericentromeric region suggests that, at least in this species, sequences, which are still found on the Y chromosome, might have been accumulated on the female X,X, pair after sex chromosome emergence. Because the heteromorphic Y is probably the result of a tandem fusion of auto- somes and morphologically undifferentiated sex chromosomes, this event may have been followed by a reduction in recombination and by formation of new linkage groups between genes that were originally found on different chromosomes, including sexually antagonistic ones (Cioffi et al. 2012, Yano et al. 2014). The interstitial chromomycin-positive heterochromatic region of the q arm, corre- sponding to the region involved in the tandem fusion event (Morescalchi et al. 1992), seems to be a good candidate for the breakpoint of rearrangement, also due to the presence of a selective, preferential accumulation of repetitive sequences and transposable elements. In a previous paper we mapped a mobile element belonging to the Tcl/mariner DNA transposon family on the q arm of the Y chromosome (Capriglione et al. 2002). The L1/CIN4 LINE isolated from the present Y-specific mini-library is also located interstitially on the long arm of the Y chromosome and might be part of this segment. These multiple ancient L1 lineages, which are occasionally found in the majority of teleost genomes, might represent the ancestral state of vertebrate L1 and are often still active (Furano et al. 2004). These elements are known to provide the machinery for retro-duplication, promoting the trafficking of particular genes on and off the sex chromosomes (Geschwend et al. 2012). Their location suggested that these mobile Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 9 elements and, perhaps, other as yet unidentified elements, may have constituted a hot- spot for chromosome rearrangement and Y shaping, playing a role in the induction of chromosome rearrangement and the appearance of the Y chromosome in C. hamatus. This Y-specific repetitive sequence could also be involved in Y chromosome differen- tiation in C. hamatus, since differential accumulation of repeats, i.e. microsatellites, is one of the earliest stages of sex-chromosome differentiation (Jones and Singh 1985, Arnemann et al. 1986, Schlotterer 2000, Kubat et al. 2008, Pokorna et al. 2011). Repetitive sequences preserved in teleost species have helped to identify conserved genetic synteny and measure the degree and patterns of sex-chromosome differentia- tion in comparative genomic studies of fish (Nanda et al. 1990, Brunelli et al. 2008, Ciofh et al. 2011, Shikano et al. 2011). The microsatellite sequence isolated from the C. hamatus Y chromosome in our study appears to be conserved. In addition, it aligned with several loci in the genome of ancient and modern fishes, including 7. newnesi, an Antarctic notothenioid. The presence of Y chromosome-specific microsatellites is well established in litera- ture, mainly in mammals and the variability of their loci has been widely exploited to generate haplotypes for phylogenetic and forensic analysis (Goldstein et al. 1995, Sun et al. 2009). In lower vertebrates this correlation is less clear, even though the accu- mulation of Bkm repeats containing tandem arrays of GATA tetranucleotides on the degenerated W chromosomes of advanced snakes is one of the most extensively studied events of sex chromosome differentiation. In fish, comparative genomic studies have shown that some of these microsatellite sequences, preserved in different teleost species, can help to examine conserved genetic sinteny, to clarify phylogeny as well as to measure the degree and patterns of sex chro- mosome differentiation (Brunelli et al. 2008, Cioffi et al. 2011, Yano et al. 2014). Finally, although the present data do not allow any hypothesis to be advanced, it is intriguing that in E. burgeri this sequence is found in Sox? mRNA for Sry-box protein 9, which together with steroidogenic factor 1 regulates transcription of the anti-Muellerian hormone (AMH) gene (Ota et al. 2007). With regard to the partial CHD1 gene sequences found in one of our Y clones, two CHD 1 gene homologues have been described in birds, which are characterized by ZW female heterogamety. In birds these homologues are associated with the heteromor- phic sex-chromosome pair, one being W-linked and the other Z-linked (Fridolfsson and Hellegren 2000). However, CHD/ genes have not been found to be sex-linked in eutherian mammals or in other organisms. Even though the SDR has been identified in some teleost species (Froschauer et al. 2002, Volff and Schartl 2002, Volff et al. 2003), little is known about the loss and gain of fish genes involved in the molecular dynamics of the sex-specific region of sex chromosomes. The mechanisms controlling sex determination and differentiation in lower vertebrates remain unclear, since different genes seem to be involved, depending on species. For this reason it is difficult to say whether the partial CHDJ homologue isolated in the Ch. hamatus Y mini-library might belong to the Y chromosome regions linked to sex differentiation. Further sequencing studies are needed to establish this. 10 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Conclusions The data seem to confirm that sex chromosomes arose independently in distant taxa several times during fish radiation (Matsubara et al. 2006, Charlesworth and Mank 2010). In Ch. hamatus, interspersed repetitive sequences and transposable elements seem to have played a pivotal role in promoting the first steps of chromosome rear- rangement and the origin of the Y chromosome. In contrast, the present data do not allow ascribing the presence of the CHD gene, related to the sex chromosomes only in avian genomes, to the Y-chromosome SDR. Of course, this finding may merely be the result of convergent evolution. The repetitive sequences isolated in this study may be a starting point to sequence the entire male-specific region of Ch. hamatus, and further research may provide additional data on Y-chromosome gene linkage and genome organization. Acknowledgements This work was supported by the Italian M. U. R. S. T. (Ministry of the University and Scientific and Technological Research)-PRIN 2005. References Almeida-Toledo LF, Daniel-Silva MFZ, Lopes CE, Toledo-Filho SA (2000) Sex chromosome evolution in fish: H. Second occurrence of an X1X2Y sex chromosome system in Gymno- tiformes. Chromosome Research 8: 335—340. doi: 10.1023/A:1009287630301 Arnemann J, Jakubiczka S, Schmidtke J, Schafer R, Epplen JT (1986) Clustered GATA repeats (Bkm sequences) on the human Y chromosome. Human Genetics 73(4): 301-303. doi: 10.1007/BF00279090 Badenhorst D, Dobigny G, Robinson TJ (2012) Karyotypic evolution of Hapalomys inferred from Chromosome Painting: a detailed characterization contributing to new insights into the ancestral Murinae karyotype. Cytogenetic and Genome Research 136(2): 83-88. doi: 10.1159/000335286 Bigoni F, Stanyon R, Koehler U, Morescalchi MA, Wienberg J (1997) Mapping homology between human and black and white Colobinae monkey chromosomes by fluorescent #7 situ hybridation. American Journal of Primatology 42(1): 289-298. doi: 10.1002/(SICT) 1098-2345 Bohne A, Sengstag T, Salzburger W (2014) Comparative transcriptomics in East African cichlids reveals sex- and species-specific expression and new candidates for sex differentiation in fishes. Genome Biology and Evolution 6(9): 2567-2585. doi: 10.1093/gbe/evu200 Brunelli JP, Wertzler KJ, Sundin K, Thorgaard GH (2008) Y-specific sequences and polymor- phisms in rainbow trout and chinook salmon. Genome 51(9): 739-748. doi: 10.1139/ G08-060 Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... hi Capriglione T, Odierna G, Caputo V, Canapa A, Olmo E (2002) Characterization of a Tcl- like transposon in the Antarctic ice-fish, Chionodraco hamatus. Gene 295(2): 193-198. doi: 10.1016/S0378-1119(02)00729-1 Caputo V, Nisi Cerioni P, Splendiani A, Capriglione T, Odierna G, Olmo E (2002) Chro- mosomal studies on ten species of notothenioid fishes (Notothenioidei: Bathydraconidae, Channichthyidae, Nototheniidae). Cytogenetic and Genome Research 98(4): 285-290. doi: 10.1159/000071050 Charlesworth B (2004) Sex determination: primitive Y chromosomes in fish. Current Biology 14(18): R745—-R747. doi: 10.1016/j.cub.2004.09.009 Charlesworth D, Charlesworth B, Marais G (2005) Steps in the evolution of heteromorphic sex chromosomes. Heredity 95: 118-128. doi: 10.1038/sj.hdy.6800697 Charlesworth D, Mank J (2010) The birds and the bees and the flowers and the trees: Lessons from genetic mapping of sex determination in plants and animals. Genetics 186(1): 9-31. doi: 10.1534/genetics.110.117697 Ciofii MB, Kejnovsky E, Bertollo LA (2011) The chromosomal distribution of microsatellite repeats in the genome of the wolf fish Hoplias malabaricus, focusing on the sex chromo- somes. Cytogenetic and Genome Research 132(4): 289-296. doi: 10.1159/000322058 Ciofh MB, Moreira-Filho O, Almeida-Toledo LF, Bertollo LAC (2012) The contrasting role of heterochromatin in the differentiation of sex chromosomes: an overview from Neotropical fishes. Journal of Fish Biology 80(6): 2125-2139. doi: 10.1111/j.1095-8649.2012.03272.x Cocca E, De Iorio S, Capriglione T (2011) Identification of a novel helitron transposon in the genome of Antarctic fish. Molecular Phylogenetics and Evolution 58(3): 439-446. doi: 10.1016/j.ympev.2010.12.020 Diniz D, Laudicina A, Cioffi MB, Bertollo LAC (2008) Microdissection and whole chromosome painting. Improving sex chromosome analysis in T7iportheus (Teleostei, Characiformes). Cy- togenetic and Genome Research 122(2): 163-168. doi: 10.1159/000163094 Fridolfsson AK, Ellegren H (2000) Molecular evolution of the avian CHD 1 genes on the Z and W sex chromosomes. Genetics 155(4): 1903-1912. Froschauer A, K6rting C, Katagiri T, Aoki T, Asakawa S, Shimizu N, Shartl M, VolffJN (2002) Construction and initial analysis of bacterial artificial chromosome (BAC) contigs from the sex-determining region of the platyfish Xiphophorus maculatus. Gene 295(2): 247-254. doi: 10.1016/S0378-1119(02)00684-4 Furano AV, Duvernell DD, Boissinot S (2004) L1 (LINE-1) retrotransposon diversity differs dramatically between mammals and fish. Trends in Genetics 20(1): 9-14. doi: 10.1016/j. tig.2003.11.006 Giovannotti M, Caputo V, O’Brien PC, Lovell FL, Trifonov V, Cerioni PN, Olmo E, Ferguson- Smith MA, Rens W (2009) Skinks (Reptilia: Scincidae) have highly conserved karyotypes as revealed by chromosome painting. Cytogenetic and Genome Research 127(2—4): 224-231. doi: 10.1159/000295002 Goldstein DB, Ruiz-Linares A, Feldman M, Cavalli-Sforza LL (1995) Genetic absolute dating based on microsatellites and the origin of modern humans. Proceedings of the National Academy of Sciences 92(15): 6720-6727. doi: 10.1073/pnas.92.15.6723 12 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Graves JAM (2006) Sex chromosome specialization and degeneration in mammals. Cell 124(5): 901-914. doi: 10.1016/j.cell.2006.02.024 Griffin DK, Haberman F, Masabanda J, O’Brien P, Bagga M, Sazanov A, Smith J, Burt DW, Ferguson-Smith M, Wienberg J (1999) Micro-and macro-chromosome paints generated by flow cytometry and microdissection: tools for mapping the chicken genome. Cytoge- netics and cell genetics 87(3—4): 278-281. doi: 10.1159/000015449 Gschwend AR, Weingartner LA, Moore RC, Ming R (2012) The sex-specific region of sex chromosomes in animals and plants. Chromosome Research 20(1): 57-69. doi: 10.1007/ s10577-011-9255-y Handley LL, Ceplitis H, Ellegren H (2004) Evolutionary strata on the chicken Z chromosome: implications for sex chromosome evolution. Genetics 167(1): 367-376. doi: 10.1534/ge- netics. 167.1.367 Jauch A, Wienberg J, Stanyon R, Arnold N, Tofanelli S, Ishida T, Cremer T (1992) Recon- struction of genomic rearrangements in great apes and gibbons by chromosome paint- ing. Proceedings of the National Academy of Sciences 89(18): 8611-8615. doi: 10.1073/ pnas.89.18.8611 Jones KW, Singh L (1985) Snakes and evolution of sex chromosomes. Trends in Genetics 1: 55-61. doi: 10.1016/0168-9525(85)90024-1 Kawagoshi T, Nishida C, Matsuda Y (2012) The origin and differentiation process of X and Y chromosomes of the black marsh turtle (Siebenrockiella crassicollis, Geoemydidae, Tes- tudines). Chromosome Research 20(1): 95-110. doi: 10.1007/s10577-011-9267-7 Kikuchi K, Hamaguchi S (2013) novel sex-determining genes in fish and sex chromosome evolution. Developmental Dynamics 242(4): 339-353. doi: 10.1002/dvdy.23927 Kondo I, Nanda M, Schmid M, Schartl M (2009) Sex determination and sex chromosome evolu- tion insights from medaka. Sexual Development 3(2—3): 88-98. doi: 10.1159/000223074 Kubat Z, Hobza R, Vyskot B, Kejnovsky E (2008) Microsatellite accumulation on the Y chromo- some in Silene latifolia. Genome 51(5): 350-356. doi: 10.1139/G08-024 Kuprijanova L, Odierna G, Capriglione T, Olmo E, Aprea G (2005) Chromosomal changes and form-formation, subspeciation in the wideranged Euroasian species Zootoca vivipara (evo- lution and biogeography). In: Ananjeva N, Tsinenko O (Eds) Herpetologia Petropolitana Proceedings of the 12" Ordinary General Meeting of the Societas Europaea Herpetologica, August 12—16 2003 Saint-Petersburg. Russian Journal of Herpetology 12: 47-52. Lahn BT, Page DC (1999) Four evolutionary strata on the human X chromosome. Science 286: 964-967. doi: 10.1126/science.286.5441.964 Liew WC, Bartfai R, Lim Z, Sreenivasan R, Siegfried KR, Orban L (2012) Polygenic sex deter- mination System in Zebrafish. PLoS ONE 7(4): 1-12. doi: 10.137 1/journal.pone.0034397 Machado TC, Pansonato-Alves JC, Pucci MB, Nogaroto V, Almeida MC, Oliveira C, Foresti F, Bertollo L, Moreira-Filho O, Artoni R, Vicari M (2011) Chromosomal painting and ZW sex chromosomes differentiation in Characidium (Characiformes, Crenuchidae). BMC Genetics 12: 65. doi:10.1186/1471-2156-12-65 Matsubara K, Tarui H, Toriba M (2006) Evidence for different origin of sex chromosomes in snakes, birds, and mammals and step-wise differentiation of snake sex chromosomes. Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 13 Proceedings of the National Academy of Sciences 103(48): 18190-18195. doi: 10.1073/ pnas.0605274103 Matsuda M (2005) Sex determination in the teleost medaka, Oryzias latipes. Annual Review of Genetics 39: 293-307. doi: 10.1146/annurev.genet.39.110304.095800 Morescalchi A, Hureau JC, Olmo E, Ouzouf-Costaz C, Pisano E, Stanyon R (1992) A multiple sex chromosome system in Antarctic ice-fish. Polar Biology 11: 655-661. doi: 10.1007/ BF00237962 Morescalchi A (1992) Cytogenetics and morphofunctional adaptations in Notothenioid fishes. Proceedings of the Second Meeting on Antarctic Biology (Padova, 26-28 February 1992), 93-110. Morescalchi A, Morescalchi MA, Odierna G, Stingo V, Capriglione T (1996) Karyotype and genome size of zoarcids and notothenioids (Teleostei, Perciformes) from the Ross Sea: cyto- taxonomic implications. Polar Biology 16(8): 559-564. doi: 10.1007/s003000050089 Morescalchi MA, Shempp W, Consigliere S, Bigoni F, Wienberg J, Stanyon R (1997) Mapping chromosomal homology between humans and the black-handed spider monkey by fluorescence in situ hybridization. Chromosome Research 5(8): 527-536. doi: 10.1023/A:1018489602312 Nanda I, Feichtinger W, Schmid M, Schréder JH, Zischler H, Epplen JT (1990) Simple repeti- tive sequences are associated with differentiation of the sex chromosomes in the guppy fish. Journal of Molecular Evolution 30: 456-462. doi: 10.1007/BF02101117 Nanda I, Kondo M, Hornung U, Asakawa S, Winkler C, Shimizu A, Shan Z, Haaf T, Shimizu N, Shima A, Schmid T, Schartl M (2002) A duplicated copy of DMRT1 in the sex- determining region of the Y chromosome of the medaka, Oryzias latipes. Proceedings of the National Academy of Sciences of the United States of America 99(18):11778-117783. doi: 10.1073/pnas. 182314699 Odierna G, Aprea G, Capriglione T, Puky M (2004) Chromosomal evidence for the double origin of viviparity in the European common lizards Lacerta zootoca vivipara. Herpetological Journal 14: 157-167. Ohno S (1967) Sex chromosomes and sex-linked genes. Berlin, 185 pp. doi: 10.1007/978-3- 642-88178-7 Ota KG, Kuraku S, Kuratani S (2007) Hagfish embryology with reference to the evolution of the neural crest. Nature 446: 672-675. doi: 10.1038/nature05633 Pisano E, Ghigliotti L (2009) Ribosomal genes in notothenioid fishes: focus on the chromosomal organisation. Marine Genomics 2(1): 75-80. doi: 10.1016/j.margen.2009.03.006 Pokorna M, Giovannotti M, Kratochvil L, Kasai F, Trifonov VA, O’Brien PC, Caputo V, Olmo E, Ferguson-Smith MA, Rens W (2011) Strong conservation of the bird Z chromo- some in reptilian genomes is revealed by comparative painting despite 275 million years divergence. Chromosoma 120(5): 455-468. doi: 10.1007/s00412-011-0322-0 Pokorna M, Kratochvil L, Kejnovsky E (2011) Microsatellite distribution on sex chromosomes at different stages of heteromorphism and heterochromatinization in two lizard species (Squamata: Eublepharidae: Coleonyx elegans and Lacertidae: Eremias velox). BMC Genetics 12: 90. doi: 10.1186/1471-2156-12-90 14 Ennio Cocca et al. / Comparative Cytogenetics 9(1): 1-15 (2015) Ross MT, Grafham DV, Coffey AJ (2005) The DNA sequence of the human X chromosome. Nature 434: 325-337. doi:10.1038/nature03440 Sandery MJ, Forster JW, Macadam SR, Blunden R, Jones RN, Brown S (1991) Isolation of a sequence common to A- and B-chromosomes of rye (Secale cereale) by microcloning. Plant Molecular Biology Reporter 9(1): 21-30. Scalenghe F, Turco E, Edstrém JE, Pirrotta V, Melli M (1981) Microdissection and cloning of DNA from a specific region of Drosophila melanogaster polytene chromosomes. Chromosoma 82: 205-216. doi: 10.1007/BF00286105 Schermelleh L, Thalhammer S, Heckl W, Posl H, Cremer T, Schutze K, Cremer M (1999) Laser microdissection and laser pressure catapulting for the generation of chromosome- specific paint probes. Biotechniques 27: 362-367. Schlétterer C (2000) Microsatellite analysis indicates genetic differentiation of the neo-sex chromosomes in Drosophila americana. Heredity 85: 610-616. doi: 10.1046/j.1365- 2540.2000.00797.x Shikano T, Herczeg G, Merila J (2011) Molecular sexing and population genetic inference using a sex-linked microsatellite marker in the nine-spined stickleback (Pungitius pungitius). BMC Research Notes 4: 119. doi: 10.1186/1756-0500-4-119 Stiglec R, Ezaz T, Graves JA (2007) Reassignment of chicken W chromosome sequences to the Z chromosome by fluorescence in situ hybridization (FISH). Cytogenetic and Genome Research 116: 132—134. doi: 10.1159/000097432 Stanyon R, Tofanelli S, Morescalchi MA, Agoramoorthy GA, Ryder OA, Wienberg J (1995) Cytogenetic analysis shows extensive genomic rearrangements between Red Howler (Alouatta seniculus) subspecies. American Journal of Primatology 35: 171-183. doi:10.1002/ajp.1350350302 Sun JX, Mullikin JC, Patterson N, Reich DE (2009) Microsatellites are molecular clocks that support accurate inferences about history. Molecular Biology and Evolution 26: 1017—1027. doi: 10.1093/molbev/msp025 Telenius H, Carter NP, Bebb CE, Nordenskjold M, Ponder BA, Tunnacliffe A (1992) Degene- rate oligonucleotide-primed PCR: general amplification of target DNA by a single degenerate primer. Genomics 13(3): 718-725. doi: 10.1016/0888-7543(92)90147-K Trifonov VA, Giovannotti M, O’Brien PC, Wallduck M, Lovell F, Rens W, Parise-Maltempi P, Caputo V, Ferguson-Smith MA (2011) Chromosomal evolution in Gekkonidae. I. Chromosome painting between Gekko and Hemidactylus species reveals phylogenetic relationships within the group. Chromosome Research 19(7): 843-855. doi: 10.1007/ s10577-011-9241-4 Volff JN, Schartl M (2002) Sex determination and sex chromosome evolution in the medaka, Oryzias latipes, and the platyfish, Xiphophorus maculatus. Cytogenetic and Genome Research 99: 170-177. doi: 10.1159/000071590 Volff JN, Kondo M, Schartl M (2003) Medaka dmY/dmrt1Y is not the universal primary sex-determining gene in fish. Trends in Genetics 19: 196-199. doi: 10.1016/S0168- 9525(03)00051-9 Yan C, Guan L, Hong L, Gang L, Rui Q (2010) A new protocol for extraction of COt-1 DNA from rice. African Journal of Biotechnology 9: 4482-4485. doi: 10.5897/AJB10.1999 Laser microdissection-based analysis of the Y sex chromosome of the Antarctic fish... 15 Yano CF, Carlos Bertollo LA, Molina WF, Liehr T, de Bello Cioffh M (2014) Genomic organization of repetitive DNAs and its implications for male karyotype and the neo-Y chromosome differentiation in Erythrinus erythrinus (Characiformes, Erythrinidae). Comparative Cytogenetics 8(2): 139-151. doi: 10.3897/compcytogen.v8i2.7597 Yang F, Graphodatsky AS, Li T, Fu B, Dobigny G, Wang J, Perelman PL, Serdukova NA, Su S, O’Brien PCM, Wang Y, Ferguson-Smith MA, Volobouev V, Nie W (2006) Compara- tive genome maps of the pangolin, hedgehog, sloth, anteater and human, revealed by cross- species chromosome painting: further insight into the ancestral karyotype and genome evolution of eutherian mammals. Chromosome Research 14: 283-296. doi: 10.1007/ s10577-006-1045-6 Zhou RN, Hu ZM (2007) The development of chromosome microdissection and microcloning technique and its applications in genomic research. Current Genomics 8: 67—72. doi: 10.2174/138920207780076929