Zoosyst. Evol. 98 (1) 2022, 117-127 | DOI 10.3897/zse.98.80442

yee
BERLIN

Taxonomy and natural history of Cavernocypris hokkaiensis sp. nov.,
the first ostracod reported from alpine streams in Japan

Mizuho Munakata!, Hayato Tanaka’, Keiichi Kakui?

1 Department of Natural History Sciences, Graduate School of Science, Hokkaido University, Sapporo, Hokkaido 060-0810, Japan
2 Tokyo Sea Life Park, Edogawa-ku, Tokyo 134-8587, Japan
3 Department of Biological Sciences, Faculty of Science, Hokkaido University, Sapporo, Hokkaido 060-0810, Japan

http://zoobank. org/47425689-5924-4BD7-909E-8 726BD15A873

Corresponding author: Mizuho Munakata (munakata.mizuho.kKO@elms.hokudai.ac.jp)

Academic editor: Kay Van Damme @ Received 12 January 2022 # Accepted 16 March 2022 Published 5 April 2022

Abstract

We describe the cypridoidean ostracod Cavernocypris hokkaiensis sp. nov. from riverbed sediments in an alpine stream at an
elevation of ca. 1850 m in the Taisetsu Mountains, Hokkaido, Japan. This species differs from congeners in having (1) the outer
surface of the carapace smooth, with sparse, tiny setae, but without shallow pits; (2) the carapace elongate rather than triangular in
lateral view; (3) the antennula consisting of seven podomeres; (4) first palpal podomere of maxillula with five dorsodistal and one
ventro-subdistal setae; (5) the fifth limb lacking setae b and d; and (6) the fifth limb lacking a vibratory plate. We provided the key to
the Cavernocypris species. We determined partial sequences for the cytochrome c oxidase subunit I (COI; cox1) and 18S rRNA (18S)
genes in C. hokkaiensis. Our sample contained only females, and we obtained a partial 16S rRNA sequence for the endosymbiotic
bacterium Cardinium from C. hokkaiensis, indicating the possibility that this ostracod species reproduces parthenogenetically. Our
field survey and observations of captive individuals suggested that C. hokkaiensis may be endemic to the Taisetsu Mountains, with a

low population density, narrow distributional range, and slow maturation to sexual maturity.

Key Words

Crustacea, cryophilic, Cypridoidea, ecology, lotic, Ostracoda

Introduction

The genus Cavernocypis Hartmann, 1964, one of 20
genera in the subfamily Cypridopsinae Kaufmann, 1900
(Savatenalinton 2018, 2020; Meisch et al. 2019), 1s
distinguished from the other 19 genera by the following
combination of features (cf. Smith etal. 2017): (1) carapace
elongate to triangular in lateral view, (2) left valve
overlapping right valve along ventral margin, (3) surface
of valves smooth or with small pits, (4) swimming setae
of antennae very short, (5) distal segment of maxillular
palp elongate, (6) terminal segment of seventh limb not
separated, and (7) uropodal ramus flagellum-like and
present only in females.

To date, six Cavernocypris species have been
described from the Palearctic and Nearctic regions

(Meisch et al. 2019; Kulkoylioglu 2020); in Japan, one
species, C. cavernosa Smith, 2011, has been reported
from Shiga and Shizuoka prefectures (Smith 2011;
Tanaka et al. 2015). Cavernocypris species inhabit the
interstitial environment of riverbed sediments, the littoral
zone of mountain lakes, springs, and caves (Marmonier
et al. 1989; Smith et al. 2017). Although there is little
information on their ecology, Forester (1991) found
C. wardi Marmonier, Meisch & Danielopol, 1989 only in
cold-water habitats at ca. 0-14 °C and suggested that the
species may be cryophilic.

Streams in the alpine vegetation zone between the
treeline and the permanent snow line are cold and nutrient-
poor (Niedrist and Fiireder 2017). They arise from glacial
melt, snowmelt, rain runoff, and groundwater springs and
are highly environmentally heterogeneous (Hotaling et

Copyright Munakata M et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

118

al. 2017). Many organisms inhabiting alpine streams are
endemics (e.g. Muhlfeld et al. 2011), uniquely adapted
to harsh conditions (Lencioni et al. 2009). Ostracods are
often detected in ecological research in alpine streams
(e.g., Suren 1993: Zbinden et al. 2008), but their taxonomy,
particularly outside Europe, has not been well studied.

The Taisetsu Mountains in Daisetsuzan National Park
are located in the center of Hokkaido, Japan, and consist of
several gently sloping volcanic peaks in the 2000 m class.
Above the treeline at ca. 1400-1500 m elevation (Amagai
et al. 2018), there are several aquatic features, including
alpine streams, but except for insects (e.g. Konno 2003;
Konno et al. 2003), the aquatic invertebrates have not yet
been investigated.

Here we describe a new species of Cavernocypris
from an alpine stream in the Taisetsu Mountains, the first
record of an ostracod from cold alpine waters in Japan.
We present nucleotide sequences for this species for
parts of the mitochondrial cytochrome c oxidase subunit
I (COT) and nuclear 18S rRNA (18S) genes and provide
preliminary comments on its phylogenetic position
based on 18S data. We also present information on its
natural history based on a field survey and preliminary
rearing results. Finally, we demonstrate with molecular
data (part of the mitochondrial 16S rRNA gene, 16S)
the infection of this species by Cardinium, a group of
“reproduction-manipulating” endosymbiotic — bacteria
(Ma and Schwander 2017).

Materials and methods

Sampling was conducted at seven sites, including four
streams (Stns 1-3, 7) fed by springs, a hot spring, and/
or snowmelt, two ponds (Stns 5, 6), and one waterfall
basin (Stn. 4) (Table 1, Fig. 1). Bottom sediment and
water were placed in a bucket and stirred, and all but the
sediment was filtered through a plankton net (mesh size
63 um). This process was repeated several times at each
site. Specimens were picked from the samples using a
stereomicroscope (Olympus SZX9, Japan). Geographical
coordinates and the elevation were obtained from GSI
Maps (Geospatial Information Authority of Japan 2022).
Water temperature was measured by using an O-274
thermometer (DRETEC, Japan).

Table 1. List of sampling sites in Daisetsuzan National Park.

Station number and name Environment

1. Hokkai-sawa Stream Stream fed by spring

2. Hokkai-sawa Stream Stream fed by spring and snowmelt

3. Akaishi Stream Stream fed by hot spring with high-

H,S concentration and snowmelt

4. Momizi Fall Fall basin in Akaishi Stream
5. Sugatami Pond Pond
6. Unnamed Pond Pond

7. Daisetsu Asahidake
Spring

Stream fed by spring

zse.pensoft.net

Munakata, M. et al.: A new alpine ostracod from Japan

Ostracods were fixed in 80% ethanol. The methods used
for dissection, preparation of slides, light microscopy,
scanning electron microscopy (SEM), and drawing were
as described by Munakata et al. (2021). All material
studied has been deposited in the Invertebrate Collection
of the Hokkaido University Museum (ICHUM), Sapporo,
under catalog numbers ICHUM-8247 to 8252.

The following abbreviations are used in the text: Ca,
carapace; LV, left valve; RV, right valve; H, height; L,
length; W, width; Anl, antennula; An2, antenna; Md,
mandible; Mx, maxillula; L5—7, fifth, sixth, and seventh
limbs, respectively; UR, uropodal ramus. The appendage
chaetotaxy follows Broodbakker and _ Danielopol
(1982) for Anl, Md, and Mx; Martens (1987) for An2;
Meisch (2000) for L5—7; and Meisch (2007) for UR.
The following measurements were made from digital
images by using ImageJ (Rasband 2022): L and H of
the LV and RV (LV-L, LV-H, RV-L, and RV-H); W of
the carapace (Ca-W). Measurements in the text are in
millimeters, followed by the mean value and sample size
in parentheses.

An attempt was made to extract total DNA from the
soft parts of three individuals by using a NucleoSpin
Tissue XS Kit (Macherey-Nagel, Germany) following
the manufacturer’s protocol, but only one of the three
extracts allowed successful PCR amplification. Primers
used for the PCR amplification and sequencing of
ostracod COI, ostracod 18S, and Cardinium 16S are
listed in Munakata et al. (2021), except that CLO-f2
(GGTGCGTGGGCGGCTTATT) and CLO-r2
(AAAGGGTTTCGCTCGTTATAG) (Gotoh et al.
2007) were used instead of CLO-fl and CLO-rl. PCR
amplification conditions for COI with TaKaRa Ex Taq
DNA polymerase (TaKaRa Bio, Japan), for 18S with
KOD FX Neo (Toyobo Life Science, Japan), and for 16S
with TaKaRa Ex Taq were as described by Munakata et
al. (2021). All nucleotide sequences were determined by
direct sequencing with a BigDye Terminator Kit ver. 3.1
and a 3730 DNA Analyzer (Life Technologies, USA).
Fragments were concatenated using MEGA7 (Kumar
et al. 2016). BLAST (Altschul et al. 1990) was used to
search the International Nucleotide Sequence Database
(INSD; International Nucleotide Sequence Database
Collaboration 2022) for nucleotide sequences most
similar to our sequences.

Mean water

Coordinates Elevation Sampling date
temperature

43°41'08'"N, 142°55'28"E 1853 m 3.5 (2.2-4.8) 25.vili.2020,
uo 26.vii.2021

A3°A1'17'N, 142°54'33'E 1837 m 4.1 (2.4-5.7) 25.viii.2020,
ne 26.vii.2021
43°41'23'"N, 142°54'35'E 1829 m Wes oi @: 26.vii.2021
43°43'72'"N, 142°57'41"E 813m E3s°G 27 Nii.2021
43°39'41"N, 142°49'58"E 1665 m No data 26.viii.2020
43°39'43'"N, 142°49'32"E 1597 m No data 26.viiil.2020
43°37'59"N, 142°41'31"E 445m AOE 26.viii.2020

Zoosyst. Evol. 98 (1) 2022, 117-127 119

Mt. Hokkai

Mt Ryoun Mt. Kuro-dake//

a |
Mt; Hokuchin~

/Ohachidaira_~/
/ Caldera oS) a |
Hokkai-sawa Stream

Mt Hokkai~
Je

Figure 1. Sampling sites for Cavernocypris hokkaiensis sp. nov. A. Map showing location of Daisetsuzan National Park in Japan;
B. Map showing the sampling sites (Stns 1-7) in Daisetsuzan National Park; C. Enlarged map of the area corresponding to the
square in Fig. 1B; arrow indicates the stream flow direction; D-J. Photographs of the sampling sites; D. Hokkai-sawa Stream
(Stn. 1); E. Hokkai-sawa Stream (Stn. 2); F. Akaishigawa Stream (Stn. 3); G. Momizi Fall (Stn. 4); H. Sugatami Pond (Stn. 5);
I. Unnamed pond (Stn. 6); J. Daisetsu Asahidake Spring (Stn. 7). Maps were generated by using GMT6 (A Wessel et al. 2019)
or were based on GSI Maps (B, C Geospatial Information Authority of Japan 2022). Filled and open circles indicate sites where
Cavernocypris individuals were collected or not found, respectively.

zse.pensoft.net

120

To explore the phylogenetic position of this species,
a maximum likelihood (ML) phylogenetic tree was
constructed based on the 18S dataset comprised of
66 ostracod sequences (one our sequence, and 64
cypridoidean and one pontocypridoidean (outgroup)
sequences from INSD; 1547 positions in the aligned
dataset; see Suppl. material 1-3: Table S1, Alignments
S1, S2). The detailed method and result are shown in
Suppl. material 4: File S1.

To obtain information on the life cycle, three non-
adult individuals collected on 26 July 2021 were
maintained singly in wells of a tissue culture plate filled
with water collected from sampling site Stn. 1 and
placed in a refrigerator at a temperature of 7 °C. Detritus
collected from sampling site Stn. 1 was added to each
well as a food source. Observations were made twice or
more per month.

Results

Field survey and observation of captive
individuals

Among seven sampling sites, Cavernocypris ostracods
were collected from only two sites in the Hokkai-sawa
Stream (Stns | and 2) (Fig. 1B, C). Ostracod density at both
sites was low, with fewer than 10 individuals per 500 ml of
filtered residue. No male individuals were detected.

Three captive non-adult individuals have remained
alive and active for more than five months. The body
length (LV-L) of each individual was 0.47, 0.48,
0.39 mm. No molts have been observed to date (the latest
observation was on 7 January 2022).

Taxonomy

Family Cyprididae Baird, 1845
Genus Cavernocypris Hartmann, 1964

Cavernocypris hokkaiensis sp. nov.
http://zoobank.org/3 DBCDFE2-957F-485F-A91E-036E71EC75C0
Figs 2, 3

Etymology. The epithet hokkaiensis is an adjective
referring to the type locality, Hokkai-sawa Stream in Japan.

New Japanese name. Shibare-doukutsu-kaimijinko,
referring to the habitat having low water temperature.
Shibare is derived from the Japanese verb shibare-ru
(freeze), in a Hokkaido dialect; Doukutsu-kaimijinko 1s
the Japanese name for Cavernocypris (Tanaka et al. 2015).

Type locality. Hokkai-sawa Stream, Daisetsuzan Nation-
al Park, Hokkaido, Japan (Stn. 1: 43°41'08"N, 142°55'28"E).

Holotype: female, ICHUM-8247, one slide and
one SEM stub, Stn.1, Hokkai-sawa Stream, riverbed
sediment, 26 July 2021. Paratypes (five females):
ICHUM-8248, 8249, one SEM stub and one slide for

zse.pensoft.net

Munakata, M. et al.: A new alpine ostracod from Japan

each; ICHUM-8250, 8251, one SEM stub; ICHUM-8252,
one slide, voucher specimen for LC666823 (COI) and
LC666824 (18S). Collection data for ICHUM-8249,
8252 are same as holotype; ICHUM-8248, 8251 were
collected from Stn. 2 (43°41'17"N, 142°54'33"E) on 25
August 2020; ICHUM-8250 was collected from Stn. 1
on 25 August 2020. All individuals were collected by
Mizuho Munakata.

Description of females. Measurements (in millimeters,
except for ratios) of carapace and valves: LV-L, 0.59-0.61
(0.60, N=3); LV-H, 0.30—0.31 (0.31, N= 3); LV-H/LV-L,
0.50-0.51 (0.51, N=3); RV-L, 0.58—-0.61 (0.60, N=3);
RV-H, 0.29-0.31 (0.30, N=3); RV-H/RV-L, 0.50-0.51
(0.51, N=3); Ca-W, 0.25—0.26 (0.26, N=2); Ca-W/LV-L,
0.41-0.42 (0.42, N=2).

Carapace (Fig. 2) translucent white, with black eye;
outer surface smooth, with sparse, tiny setae but without
shallow pits; widest point at about mid-length (Fig. 2A,
B); LV overlapping RV at ventral margin (Fig. 2A); no
dorsal hump on LV (Fig. 2B—D): outer list present in
ventral margin of both valves (Fig. 2A).

LV (Figs 2C, E, G, 3A) with greatest height at about
mid-length; anterior and posterior margins evenly
rounded; apex of anterior margin lower than mid-height
of LV and slightly higher than apex of posterior margin;
in inner view, calcified inner lamella on anterior and
posterior margins well developed (Figs 2E, 3A); inner
list present in ventral region (Fig. 2G); mid-ventral
margin with inner triangular projection (Fig. 2A, G). RV
(Figs 2D, F, H, 3B) similar to LV in shape; inner list in
ventral region absent (Fig. 2H). Two oblong mandibular
muscle scars and four oblong adductor muscle scars on
LV and RV (Figs 2E, F, 3A, B). Hinge adont.

An! (Fig. 3C) with seven podomeres. First podomere
with one dorsal and two ventrodistal plumed setae and
Wouters organ. Second podomere with dorsodistal seta
reaching distal edge of third podomere and Rome organ.
Third podomere with dorsodistal seta reaching distal
edge of fourth podomere and ventrodistal seta extending
beyond middle of fourth podomere. Fourth podomere
with two dorsodistal setae of unequal length (longer one
extending to distal edge of seventh podomere) and two
ventrodistal setae reaching distal edge of sixth podomere.
Fifth podomere with two dorsodistal setae of unequal
length (longer one as long as podomeres 2—7) and two
shorter ventrodistal setae. Sixth podomere with four outer
distal setae as long as podomeres 1-7 and shorter inner
distal seta. Seventh podomere with three distal setae
of unequal length and aesthetasc y, (ca. 60% length of
longest seta).

An2 (Fig. 3D) with five podomeres. First podomere
(coxa) with two ventral setae. Second podomere (basis)
with ventrosubdistal seta reaching distal edge of third
podomere. Exopodite with one long and two unequal short
setae. Third (first endopodal) podomere with six inner
subdistal short natatory setae extending slightly beyond
distal edge of third podomere, ventrodistal plumed seta
reaching distal edge of fifth podomere, and mid-ventral

Zoosyst. Evol. 98 (1) 2022, 117-127

121

Figure 2. SEM images of carapaces and valves of female Cavernocypris hokkaiensis sp. nov. A. Paratype (ICHUM-8250); B. Paratype
(ICHUM-8251); C, D. Paratype (ICHUM-8248); E, F. Holotype (CHUM-8247); G, H. Paratype (ICHUM-8249); A, B. Ventral and
dorsal views of whole carapace; C, D. Outer views of left and right valves; E, F. Inner views of left and right valves; G, H. Inner
dorsal views of left and right valves; dorsal portion of left valve broken. Arrows indicate anterior direction. Scale bars: 0.2 mm.

aesthetasc Y. Fourth podomere undivided, with two
mid-dorsal setae, dorsosubdistal setae z, , extending
beyond middle of claws G,,, mid-ventral plumed setae
t,_, of unequal length, and distal claws G, , of nearly
equal length. Fifth podomere with bifurcate aesthetasc y,
(longer part half the length of claw G,,) and claws G__ |;

G,, ca. 70% length of G,; G,, reaching tip of claws G,

Md (Fig. 3E, F) with coxa, palp comprising four (one
basal and three endopodal) podomeres, and vibratory
plate. Coxa with several distal teeth and one subdistal
plumed seta. First podomere (basis) with one ventrodistal
seta, ventrodistal setae Sess and ventrodistal short seta a;
setae S, , subequal in length, bearing row of long setules.
Vibratory plate (exopodite) with four rays. Second (first

zse.pensoft.net

122

endopodal) podomere with three dorsodistal setae of
unequal length (longest reaching tip of claws on fourth
podomere), four mid-ventral long plumed setae (not
extending beyond tip of claws on fourth podomere), and
mid-ventral plumed short seta 8 (shorter than half the
length of mid-ventral plumed setae). Third podomere
with four dorsosubdistal setae and two ventrosubdistal
setae; inner distal region with plumed seta y and two
plumed setae. Fourth podomere with two distal setae and
four distal claws.

Mx (Fig. 3G) with palp comprising two podomeres,
three endites, and vibratory plate (not illustrated). First
palpal podomere with five dorsodistal setae of unequal
length and one ventro-subdistal seta. Second palpal
podomere not spatula-like, but rectangular, with two
distal setae and three distal claws. First endite with two
ventroproximal setae and ca. nine distal setae. Second
endite with ca. eight distal setae. Third endite with two
distal serrated spines and six distal setae.

L5 (Fig. 3H) with protopod and palp; vibratory plate
absent. Protopod with two setae a and at least nine distal
plumed setae of unequal length; setae b, c, and d absent.
Palp with distal plumed setae h, ,.

L6 (Fig. 31) with six podomeres. First and second
podomeres (protopod) with seta d,. Third (first
endopodal) podomere with ventrodistal plumed seta
e reaching middle of fifth podomere. Fourth podomere
with ventrodistal plumed seta f reaching beyond distal
edge of fifth podomere. Fifth podomere with ventrodistal
plumed seta g. Sixth podomere with dorsodistal seta h,,
ventrodistal plumed seta h,, and distal curved claw h,,.

L7 (Fig. 3J) with four podomeres; third and fourth
podomeres fused to form pincer organ. First podomere
(protopod) with plumed setae doe Second (first
endopodal) podomere with ventrodistal plumed seta e not
reaching middle of fused podomeres 3 and 4. Fused third
and fourth podomeres with mid-ventral plumed seta f not
reaching tip of L7, subdistal long plumed seta h,, distal
hook-like seta h,, and subdistal tiny seta h..

UR (Fig. 3K) strongly reduced. Proximal part longer
than wide, with one seta. Distal part flagellar in shape.

Rake organ (Fig. 3L) with stout rod and ca. eight blunt
distal teeth.

Genital hooks on female copulatory organ present
(not illustrated).

Genetic information and phylogenetic analysis

The partial COI sequence (658 bp, encoding 219 amino
acids; LC666823), the nearly complete 18S sequence
(2053 bp; LC666824), and a Cardinium 16S sequence
(907 bp; LC666825) were determined from paratype
individual ICHUM-8252.

The sequences in the INSD most similar to our
sequences, determined by BLAST searches, were from
the ostracod Bennelongia scanloni Martens et al., 2013
(KF724989.1; identity score 81.28%, query cover
99%; Martens et al. 2013) for COI, from the ostracod

zse.pensoft.net

Munakata, M. et al.: A new alpine ostracod from Japan

Cypretta seurati Gauthier, 1929 (AB674999.1; identity
score 87.60%, query cover 89%; Hiruta et al. 2016) for
18S, and from “Cardinium endosymbiont of Heterocypris
spadix” (LC589665.1; identity score 98.90%, query
cover 100%; Munakata et al. 2021) for Cardinium 16S.
In our ML tree based on 18S sequences (Suppl. material
4: File S1), C. hokkaiensis appears as the sister taxon
to a strongly supported clade (97% ultrafast bootstrap
support) comprising all other cypridoideans. Cyprididae
and Cypridopsinae, in which Cavernocypris is classified,
do not appear as monophyletic.

Discussion
Morphological comparison

Cavernocypris hokkaiensis sp. nov. — resembles
C. cavernosa and C. danielopoli Smith & Kamiya, 2017
in lacking setae b and d on LS, but differs from them
in that (1) the outer surface of the carapace is smooth,
with sparse, tiny setae, but without shallow pits (pits
present in C. cavernosa and C. danielopoli), (2) the
carapace is elongate rather than triangular in lateral view
(triangular in C. danielopoli); (3) first palpal podomere
of Mx has five dorsodistal and one ventro-subdistal setae
(only five dorsodistal setae present in C. danielopoli;
not described in C. cavernosa), and (4) L5 lacks the
vibratory plate (vibratory plate present in C. cavernosa
and C. danielopoli). Character states in all congeners are
summarized in Table 2.

Reproductive mode

Our sample comprised only females, indicating
that C. hokkaiensis may be parthenogenetic. The
endosymbiotic bactertum Cardinium has _ previously
been detected (e.g., by means of 16S sequences) in non-
marine ostracods engaged in parthenogenetic or mixed
reproduction, and infection with Cardinium might be a
causative factor in the parthenogenetic reproductive mode
(Schon and Martens 2019). Our study is the first to detect
Cardinium in a species of Cavernocypris, implying that
C. hokkaiensis may be parthenogenetic. It should be noted
that male individuals have likewise not been reported
among the congeners C. cavernosa, C. danielopoli,
C. wardi, and some populations of C. subterranea (Wolf,
1920) (Marmonier et al. 1989; Ktlkoylioglu and Vinyard
1998; Smith 2011; Smith et al. 2017).

Ecology, distribution, and life cycle

The results of our field survey suggest that C. hokkaiensis
is distributed in an extremely narrow area, only in Hokkai-
sawa Stream. It was not found at three sites distant from
Hokkai-sawa Stream (Stns 5, 6, and 7). Its absence at two
sites in Akaishi Stream (Stns 3 and 4), which Hokkai-sawa

Zoosyst. Evol. 98 (1) 2022, 117-127 123

Figure 3. Cavernocypris hokkaiensis sp. nov., female. A-G, I-L. Holotype (ICHUM-8247); H. Paratype (ICHUM-8249); A, B. Inner
views of left and right valves; C. Antennula; D. Antenna, outer view; E. Coxa of mandible; F. Mandible, inner view; G. Maxillula
(vibratory plate omitted); H—J. Limbs 5—7; setules of distal setae on protopod and palp of limb 5 omitted; K. Uropodal ramus;
L. Rake organ. Abbreviations: RO, Rome organ; WO, Wouters organ. Scale bars: 0.2 mm (A, B); 0.5 mm (C—K); 0.25 mm (L).

zse.pensoft.net

124

Munakata, M. et al.: A new alpine ostracod from Japan

Table 2. Comparison of morphological characteristics between species of Cavernocypris.

C. cavernosa C. coreana C. danielopoli | C. reddelli | C. subterranea C. wardi c. pera
Shape of valves elongate triangular elongate elongate elongate elongate
with numerous with elongate with small
shallow pits, shallow pits shallow pits
most distinct in central , in a central
; ,; with small
towards ante- with very finely area, and with transverse
Surface of valves ; shallow ent. smooth smooth
rior and poste- pitted much smaller ; band; pits may
; ; pits
rior margins, rounded pits be reduced or
less distinct in in posterior even absent
central area region
Number of Anl 7 7 7 7 7
podomeres
Number of setae on 1*t TePdeecriaed 5 distal and 1 5 distal 5 distal 5 distal and 1 | 4 distal and 1 | 5 distal and 1
podomere of Mx-palp subdistal subdistal subdistal subdistal
Seta b on L5 absent present absent absent present present absent
Seta don L5 absent absent present present present absent
Number of rays compris- 5 A A 5 3 0
ing vibratory plate on L5
Menelz|c 222) Smith et al. | Kulkoyluoglu al Wea Marmonier et
Reference Smith (2011) Marmonier et al. (2017) (2020) Marmonier et al. (1989) this study
(1989) al. (1989)

Stream joins, may be related to environmental differences
between two streams. Hokkai-sawa Stream is fed by
spring water and snowmelt, and is thus cold (1.4—6.8 °C
measured in the summer season; Table 1; Konno et al.
2003) and slightly acidic (pH 6.2; Konno et al. 2003). In
contrast, Akaishi Stream is fed by water from the Yudoku-
onsen hot spring in the Ohachidaira Caldera, which has
high water temperature (48 °C) and high H,S content
(245 mg/l) (Uzumasa et al. 1959), and measurements
taken at Stn. 3 indicate that Akaishi Stream is warmer
(13 °C) and more acidic (pH 2.8—3.3) than Hokkai-sawa
Stream (Table 1; Konno et al. 2003). No pH data were
available for our Stn. 4, but the water temperature was
similar to that at Stn. 3 (13 °C; Table 1). Based on samples
collected from sites almost identical to our Stns 1 and 3
in Hokkai-sawa and Akaishi Streams, Konno et al. (2003)
found no lotic aquatic insects in common between the two
streams. The warmer, more acidic condition of Akaishi
Stream may be an unsuitable habitat for C. hokkaiensis.
Our rearing experiment, though we could prepare only
three live individuals, provided preliminary data about the life
history of C. hokkaiensis. We observed no molting by captive
C. hokkaiensis individuals for more than five months at 7 °C.
Ostracod life cycles typically comprise eight non-adult and

one adult instars, 1.e., ostracods molt eight times before
becoming sexually mature adults. Instars are not uniform in
duration, but tend to become longer with successive instars
(e.g., Heip 1976; Liberto et al. 2014). Although we could not
determine the true instar for three captive individuals, their
estimated instar was A-1 (0.47- and 0.48-mm individuals) or
A-2 (0.39-mm individual) if this species follows Brooks’s
rule (Brooks 1886; Watabe and Kaesler 2004). Our result
could be an artefact from the artificial conditions during
culturing, but it may also be a natural phenomenon, and we
could speculate that this species may require more than a
year to become sexually mature.

Our field survey and observation of captive individuals
may indicate that C. hokkaiensis is an endemic species
adapted to the harsh alpine environment of the Taisetsu
Mountains, with a low population density, narrow
distributional range, and potentially slow maturation. If
this is the case, then habitat loss and fragmentation due
to anthropogenic activities, or a decrease in snowfall and
snowfields due to climate change, could lead to a rapid
population decline of this species. Additional ecological
and biological information is necessary to confirm
whether C. hokkaiensis is a narrow endemic, and to
design an informed conservation strategy.

Key to the Cavernocypris species (modified after Ktlk6yliioglu (2020))

ail ActLawithl 7POOGOieteS .. ames erat uted Reendl be Bane
AILS WIS BOGOMEFES 2 sates ' Theda, elon ps nee Sonne

ARE 1 Lid roa aoe a aay Ome C. coreana (McKenzie, 1972)

2 6" swimming seta of An2 longer than the other 5 setae, second podomere of Md-palp with B+4 setae... 3
- 6" swimming seta of An2 shorter than others, second podomere of Md-palp with B+3 Setae...........cccccccccceceeeeeeeeeea cena

3 STS Y Sideriole isola ome nls ee meee 06, RNR REEOMNE RE 2B

- Seta b absent from L5

eR nape aes Sv C. reddelli KulkoylUoglu, 2020

4 First palpal podomere of Mx with 5 distal and 1 subdistal setae, vibratory plate of L5 with 2 rayS............ eects

PU Me OOS s FID ee Paes Tea wer aL PI ee C. subterranea (Wolf, 1920)

- First palpal podomere of Mx with 4 distal and 1 subdistal setae, vibratory plate of L5 with 3 rayS............ eee

zse.pensoft.net

Reset debt eel eos C. wardi Marmonier, Meisch & Danielopol, 1989

Zoosyst. Evol. 98 (1) 2022, 117-127 125
5 Carapace triangular in lateral view, with distinctive hump on LV .............:::e:ceeeeeeees C. danielopoli Smith & Kamiya, 2017
- Carapace élongate.in lateral view, withOUtshUnnpe2Or Et, : ccxscnes enedasds reine teeb iene sg el pnncis sscmeeeckee hoes fimmdesesshap haces teedsgeniannetennes 6
6 Surface of valves covered with numerous shallow pits, vibratory plate of L5 with 2 rays......... C. cavernosa Smith, 2011

- Surface of valves smooth, L5 without vibratory plate ......

Acknowledgements

We thank Akane Saito and Sota Matsuno in the Ministry
of the Environment for support in obtaining a sampling
permit; Yuki Kita at Hokkaido University (HU) for
supporting the field work; Akira Tsukagoshi at Shizuoka
University for literature; Yuki Oya at HU for helping
with molecular analyses; and Matthew H. Dick at HU for
reviewing the manuscript and editing the English. Permit
numbers 1910241 and 2104201 allowed field sampling
of animals in Daisetsuzan National Park. This study was
funded in part by a research grant from the Research
Institute of Marine Invertebrates Foundation to MM.

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic
local alignment search tool. Journal of Molecular Biology 215(3):
403-410. https://doi.org/10.1016/S0022-2836(05)80360-2

Amagai Y, Kudo G, Sato K (2018) Changes in alpine plant communities
under climate change: Dynamics of snow-meadow vegetation in
northern Japan over the last 40 years. Applied Vegetation Science
21(4): 561-571. https://doi.org/10.1111/avsc. 12387

Baird W (1845) Description of some new genera and species of British
Entomostraca. Annals & Magazine of Natural History 17(114): 410-
416. https://doi.org/10.1080/037454809495847

Broodbakker NW, Danielopol DL (1982) The chaetotaxy of Cypridacea
(Crustacea, Ostracoda) limbs: Proposals for a _ descriptive
model. Bijdragen tot de Dierkunde 52(2): 103-120. https://doi.
org/10.1163/26660644-05202003

Brooks WK (1886) Report on the Stomatopoda dredged by H. M. S.
Challenger during the years 1873-1876. Report on the scientific re-
sults of the voyage of H. M. S. Challenger. Zoology (Jena, Germa-
ny) 16: 1-116. https://doi.org/10.5962/bh1.title.989 1

Forester RM (1991) Ostracode assemblages from springs in the western
United States: Implications for paleohydrology. Memoirs of the
Entomological Society of Canada 123(S155): 181-201. https://doi.
org/10.4039/entm123155181-1

Gauthier H (1929) Ostracodes et cladoceres du Sahara central. Bulle-
tin de la Société d’Histoire Naturelle de l’Afrique du Nord 20(2):
143-162.

Geospatial Information Authority of Japan (2022) GSI Maps. https://maps.
gsi.go.jp/ [Accessed on 8 January 2022]

Gotoh T, Noda H, Ito S (2007) Cardinium symbionts cause cytoplasmic
incompatibility in spider mites. Heredity 98(1): 13-20. https://doi.
org/10.1038/s}.hdy.6800881

Hartmann G (1964) Asiatische Ostracoden,
zoogeographische Untersuchungen.

systematische und

Internationale Revue der
Gesamten Hydrobiologie. Systematische Beihefte 3: 1-155.

Heip C (1976) The life-cycle of Cyprideis torosa (Crustacea, Ostracoda).
Oecologia 24(3): 229-245. https://doi.org/10.1007/BF00345475

BPP Boos Fink tuen seve ON MACs opel take Puy BOR AUER Ce: i C. hokkalensis Sp. nov.

Hiruta S, Kobayashi N, Katoh T, Kajihara H (2016) Molecular phylogeny
of cypridoid freshwater ostracods (Crustacea: Ostracoda), inferred
from 18S and 28S rDNA sequences. Zoological Science 33(2): 179-
185. https://doi.org/10.2108/zs150103

Hotaling S, Finn D, Giersch J, Weisrock D, Jacobsen D (2017) Cli-
mate change and alpine stream biology: Progress, challenges, and
opportunities for the future. Biological Reviews of the Cambridge
Philosophical Society 92(4): 2024-2045. https://doi.org/10.1111/
brv.12319

International Nucleotide Sequence Database Collaboration (2022)
International Nucleotide Sequence Database. https://www.insdc.
org/ [Accessed on 8 March 2022]

Kaufmann A (1900) Cypriden und Darwinuliden der Schweiz. Revue
Suisse de Zoologie 8(3): 209-423. https://doi.org/10.5962/bhl.
part. 10584

Konno Y (2003) Lentic aquatic insects in the ponds of a palsa
bog in Daisetsuzan National Park, Hokkaido. Japanese Journal
of Limnology 64(2): 145-149. _ https://doi.org/10.3739/
rikusui.64.145

Konno Y, Nishimoto H, Maruyama H, Torii T, Ishiwata S (2003)
Lotic aquatic insects in the alpine zone of Daisetsuzan National
Park. Japanese Journal of Limnology 64(2): 141-144. https://doi.
org/10.3739/rikusui.64.141

Kulkoyltioglu O (2020) A new species of Cavernocypris (Ostracoda)
from Texas (U.S.A.) with a taxonomic key. Journal of Species
Research 9(2): 122-130.

Kulkoylioglu O, Vinyard G (1998) New bisexual form of Cavernocypris
subterranea (Wolf, 1920) (Crustacea, Ostracoda) from Idaho.
The Great Basin Naturalist 58(4): 380-385. http://www.jstor.org/
stable/41713076

Kumar S, Stecher G, Tamura K (2016) MEGA7: Molecular Evolution-
ary Genetics Analysis version 7.0 for bigger datasets. Molecular
Biology and Evolution 33(7): 1870-1874. https://doi.org/10.1093/
molbev/msw054

Lencioni V, Boschini D, Rebecchi L (2009) Expression of the 70 kDa
heat shock protein family in alpine freshwater chironomids (Diptera,
Chironomidae) under natural conditions. Journal of Limnology
68(2): 251-256. https://doi.org/10.4081/jlimnol.2009.251

Liberto R, César II, Mesquita-Joanes F (2014) Postembryonic growth
in two species of freshwater Ostracoda (Crustacea) shows a size-
age sigmoid model fit and temperature effects on development time,
but no clear temperature-size rule (TSR) pattern. Limnology 15(1):
57-67. https://doi.org/10.1007/s10201-013-0413-0

Ma WJ, Schwander T (2017) Patterns and mechanisms in instances of
endosymbiont-induced parthenogenesis. Journal of Evolutionary
Biology 30(5): 868-888. https://doi.org/10.1111/jeb.13069

Marmonier P, Meisch C, Danielopol DL (1989) A review of the genus
Cavernocypris Hartmann (Ostracoda, Cypridopsinae): Systematics,
ecology and biogeography. Bulletin (Societe des Naturalistes
Luxembourgeois) 89: 221—278.

Martens K (1987) Homology and functional morphology of the sexual
dimorphism in the antenna of Sclerocypris Sars, 1924 (Crustacea,

zse.pensoft.net

126

Ostracoda, Megalocypridinae). Bijdragen tot de Dierkunde 57(2):
183-190. https://doi.org/10.1163/26660644-05702003

Martens K, Halse S, Schon I (2013) On the Bennelongia barangaroo
lineage (Crustacea, Ostracoda) in Western Australia, with the
description of seven new species. European Journal of Taxonomy
66: 1-59. https://doi.org/10.5852/ejt.2013.66

McKenzie KG (1972) Results of the speleological survey in South
Korea 1966. Bulletin of the National Science Museum, Tokyo 15(1):
155-166.

Meisch C (2000) Freshwater Ostracoda of Western and Central Europe.
Spektrum Akademischer Verlag, Berlin, xii + 522 pp.

Meisch C (2007) On the origin of the putative furca of the Ostracoda
(Crustacea). In: Matzke-Karasz R, Martens K, Schudack M (Eds)
Ostracodology — Linking Bio- and Geosciences. Springer, Dordrecht,
181-200. https://doi.org/10.1007/978-1-4020-6418-0_14

Meisch C, Smith RJ, Martens K (2019) A subjective global checklist
of the extant non-marine Ostracoda (Crustacea). European Journal
of Taxonomy 492: 1-135. https://doi.org/10.5852/ejt.2019.492

Muhlfeld CC, Giersch JJ, Hauer FR, Pederson GT, Luikart G, Peterson
DP, Downs CC, Fagre DB (2011) Climate change links fate of gla-
ciers and an endemic alpine invertebrate. Climatic Change 106(2):
337-345. https://doi.org/10.1007/s10584-011-0057-1

Munakata M, Tanaka H, Kaku K (2021) Heterocypris spadix sp. nov.
(Crustacea: Ostracoda: Cypridoidea) from Japan, with informa-
tion on its reproductive mode. Zoological Science 38(3): 287-296.
https://doi.org/10.2108/zs200127

Niedrist GH, Fureder L (2017) Trophic ecology of alpine stream inver-
tebrates: Current status and future research needs. Freshwater Sci-
ence 36(3): 466-478. https://doi.org/10.1086/69283 1

Rasband WS (2022) ImageJ. https://imagej.nih.gov/1j/ [Accessed on 18
February 2022]

Savatenalinton S (2018) New genus of subfamily Cypridopsinae
Kaufmann, 1933 (Crustacea: Ostracoda) from Thailand. European
Journal of Taxonomy 487: 1-17. https://doi.org/10.5852/
ejt.2018.487

Savatenalinton S (2020) A new cypridopsine genus (Crustacea, Os-
tracoda) from Thailand. European Journal of Taxonomy 631: 1—16.
https://doi.org/10.5852/ejt.2020.631

Schon I, Martens K (2019) Are Cardinium infections causing asexu-
ality in non-marine ostracods? Hydrobiologia 847(7): 1651-1661.
https://doi.org/10.1007/s10750-019-04110-2

Smith RJ (2011) Groundwater, spring and interstitial Ostracoda
(Crustacea) from Shiga Prefecture, Japan, including descriptions
of three new species and one new genus. Zootaxa 3140(1): 15-37.
https://do1.org/10.11646/zootaxa.3140.1.2

Smith RJ, Kamiya T, Choi YG, Lee J, Chang CY (2017) A new spe-
cies of Cavernocypris Hartmann, 1964 (Crustacea: Ostracoda)
from caves in South Korea. Zootaxa 4268(3): 360-376. https://do1.
org/10.11646/zootaxa.4268 3.3

Suren A (1993) Bryophytes and associated invertebrates in first-order
alpine streams of Arthur’s Pass, New Zealand. New Zealand Journal
of Marine and Freshwater Research 27(4): 479-494. https://doi.org/
10. 1080/00288330.1993.9516589

Tanaka H, Kotorii H, Yokozawa K, Wakabayashi F, Kimoto K, Sano
K (2015) Distribution and occurrence of freshwater Ostracoda
(Crustacea) from southwest region of Mt. Fuji. Taxa 38: 26-41. https://
www.jstage.jst.go.jp/article/taxa/38/0/38_KJ00009847304/_ pdf

zse.pensoft.net

Munakata, M. et al.: A new alpine ostracod from Japan

Uzumasa Y, Nasu Y, Seo T (1959) Chemical investigations of hot
springs in Japan. 45-48. 47: On the hot springs in the central
Hokkaido. Journal Chemical Society of Japan 80: 999-1002. https://
doi.org/10.1246/nikkashil948.80.9_999

Watabe K, Kaesler RL (2004) Ontogeny of a new species of
Paraparchites (Ostracoda) from the lower Permian Speiser Shale
in Kansas. Journal of Paleontology 78(3): 603-611. https://doi.
org/10.1666/0022-3360(2004)078<0603: COANSO>2.0.CO;2

Wessel P, Luis JF, Uieda L, Scharroo R, Wobbe F, Smith WHF, Tian
D (2019) The generic mapping tools version 6. Geochemistry
Geophysics Geosystems 20(11): 5556-5564. _ https://doi.
org/10.1029/2019GC008515

Wolf JP (1920) Die Ostrakoden aus der Umgebung von Basel. Archiv
fur Naturgeschichte, Abteilung A 85: 1-100. https://www.biodiver-
sitylibrary.org/bibliography/12938

Zbinden M, Hieber M, Robinson CT, Uehlinger U (2008) Short-term
colonization patterns of macroinvertebrates in alpine streams.
Fundamental and Applied Limnology 171(1): 75-86. https://doi.
org/10.1127/1863-9135/2008/0171-0075

Supplementary material |

Table SI

Authors: Mizuho Munakata, Hayato Tanaka, Keiichi Kakui

Data type: table (Excel format)

Explanation note: List of species included in the
molecular phylogenetic analysis and_ respective
GenBank accession numbers.

Copyright notice: This dataset is made available under
the Open Database License (http://opendatacommons.
org/licenses/odbl/1.0/). The Open Database License
(ODbL) is a license agreement intended to allow us-
ers to freely share, modify, and use this Dataset while
maintaining this same freedom for others, provided
that the original source and author(s) are credited.

Link: https://doi.org/10.3897/zse.98.80442.suppl1

Supplementary material 2

Alignment SI

Authors: Mizuho Munakata, Hayato Tanaka, Keiichi Kaku

Data type: molecular dataset (fasta format)

Explanation note: Aligned 18S sequences used for the
maximum-likelihood analysis, trimmed in MEGA7 to
the shortest length among the sequences.

Copyright notice: This dataset is made available under
the Open Database License (http://opendatacommons.
org/licenses/odbl/1.0/). The Open Database License
(ODbL) is a license agreement intended to allow us-
ers to freely share, modify, and use this Dataset while
maintaining this same freedom for others, provided
that the original source and author(s) are credited.

Link: https://doi.org/10.3897/zse.98.80442.suppl2

Zoosyst. Evol. 98 (1) 2022, 117-127

Supplementary material 3
Alignment S82

Authors: Mizuho Munakata, Hayato Tanaka, Keiichi Kakui

Data type: molecular dataset (fasta format)

Explanation note:Aligned 18S sequences used for the
maximum-likelihood analysis, reduced to 1547 positions
by removing alignment-ambiguous sites with Gblocks
ver. 0.91b in NGPhylogeny. fr under “relaxed” parameters.

Copyright notice: This dataset is made available under
the Open Database License (http://opendatacommons.
org/licenses/odbl/1.0/). The Open Database License
(ODbL) is a license agreement intended to allow us-
ers to freely share, modify, and use this Dataset while
maintaining this same freedom for others, provided
that the original source and author(s) are credited.

Link: https://do1.org/10.3897/zse.98.80442.suppl3

127

Supplementary material 4
File SI

Authors: Mizuho Munakata, Hayato Tanaka, Keiichi Kakui

Data type: text with one figure (docx format)

Explanation note: Phylogenetic analysis of cypridoidean
ostracods based on 18S rRNA sequences.

Copyright notice: This dataset is made available under
the Open Database License (http://opendatacom-
mons.org/licenses/odbl/1.0/). The Open Database
License (ODbL) is a license agreement intended to
allow users to freely share, modify, and use this Data-
set while maintaining this same freedom for others,
provided that the original source and author(s) are
credited.

Link: https://do1.org/10.3897/zse.98.80442 suppl4

zse.pensoft.net