CompCytogen 16(1): I-17 (2022) COMPARATIVE A reerrerewet open-access oven

doi: 10.3897/compcytogen.v | 6.i1.76260 Kan Cytogenetics

https://compcytogen.pensoft.net International journal of Plant & Animal Cytogenetics,
i

Karyosystematics, and Molecular Systematics

Comparative cytogenetics on eight Malagasy
Mantellinae (Anura, Mantellidae) and a synthesis of
the karyological data on the subfamily

Marcello Mezzasalma!*, Franco Andreone?, Gaetano Odierna’‘,

Fabio Maria Guarino’, Angelica Crottini!?»

| CIBIO Research Centre in Biodiversity and Genetic Resources, InBIO, Universidade do Porto, Campus
Agririo de Vairio, Rua Padre Armando Quintas, No 7, 4485-661 Vairao, Portugal 2. BIOPOLIS Program in

Genomics, Biodiversity and Land Planning, CIBIO, Campus de Vairio, 4485-661 Vairio, Portugal 3 Museo

Regionale di Scienze Naturali, Via G. Giolitti 36, 10123 Torino, Italy 4 Department of Biology, University of
Naples Federico II, Via Cinthia 26, 80126, Naples, Italy 5 Departamento de Biologia, Faculdade de Ciéncias,

Universidade do Porto, 4099-002 Porto, Portugal

Corresponding author: Marcello Mezzasalma (m.mezzasalma@gmail.com)

Academic editor: Rafael Noleto | Received 7 October 2021 | Accepted 20 December 2021 | Published 11 February 2022
http://zoobank. org/40F08 D44-8889-470C-A4D7-94FF17C3CCEA

Citation: Mezzasalma M, Andreone F, Odierna G, Guarino FM, Crottini A (2022) Comparative cytogenetics on eight
Malagasy Mantellinae (Anura, Mantellidae) and a synthesis of the karyological data on the subfamily. Comparative
Cytogenetics 16(1): 1-17. https://doi.org/10.3897/compcytogen.v16.i1.76260

Abstract

We performed a molecular and cytogenetic analysis on different Mantellinae species and revised the
available chromosomal data on this group to provide an updated assessment of its karyological diver-
sity and evolution. Using a fragment of the mitochondrial 16S rRNA, we performed a molecular taxo-
nomic identification of the samples that were used for cytogenetic analyses. A comparative cytogenetic
analysis, with Giemsa’s staining, Ag-NOR staining and sequential C-banding + Giemsa + CMA + DAPI
was performed on eight species: Gephyromantis sp. Cal9, G. striatus (Vences, Glaw, Andreone, Jesu et
Schimmenti, 2002), Mantidactylus (Chonomantis) sp. Call, M. (Brygoomantis) alutus (Peracca, 1893),
M. (Hylobatrachus) cowanii (Boulenger, 1882), Spinomantis prope aglavei “North” (Methuen et Hewitt,
1913), S. phantasticus (Glaw et Vences, 1997) and S. sp. Ca3. Gephyromantis striatus, M. (Brygoomantis)
alutus and Spinomantis prope aglavei “North” have a karyotype of 2n = 24 chromosomes while the other
species show 2n = 26 chromosomes. Among the analysed species we detected differences in the number
and position of telocentric elements, location of NOR loci (alternatively on the 6", 7" or 10" pair) and in
the distribution of heterochromatin, which shows species-specific patterns. Merging our data with those
previously available, we propose a karyotype of 2n = 26 with all biarmed elements and loci of NORs on the

6" chromosome pair as the ancestral state in the whole family Mantellidae. From this putative ancestral

Copyright Marcello Mezzasalma et al. This is an open access article distributed under the terms of the Creative Commons Attribution License
(CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

2 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

condition, a reduction of chromosome number through similar tandem fusions (from 2n = 26 to 2n =
24) occurred independently in Mantidactylus Boulenger, 1895 (subgenus Brygoomantis Dubois, 1992),
Spinomantis Dubois, 1992 and Gephyromantis Methuen, 1920. Similarly, a relocation of NORs, from
the putative primitive configuration on the 6" chromosome, occurred independently in Gephyroman-
tis, Blommersia Dubois, 1992, Guibemantis Dubois, 1992, Mantella Boulenger, 1882 and Spinomanitis.
Chromosome inversions of primitive biarmed elements likely generated a variable number of telocentric
elements in Mantella nigricans Guibé, 1978 and a different number of taxa of Gephyromantis (subgenera
Duboimantis Glaw et Vences, 2006 and Laurentomantis Dubois, 1980) and Mantidactylus (subgenera
Brygoomantis, Chonomantis Glaw et Vences, 1994, Hylobatrachus Laurent, 1943 and Ochthomantis Glaw
et Vences, 1994).

Keywords
Amphibia, chromosome evolution, karyotype, Madagascar, NORs

Introduction

Madagascar is one of the richest biodiversity hotspots and an ideal region to study evo-
lutionary dynamics (Myers et al. 2000; Ganzhorn et al. 2001; Vences et al. 2009). The
native amphibians of Madagascar belong to four distinct anuran families: Hyperolii-
dae, Mantellidae, Microhylidae and Ptychadenidae (Glaw and Vences 2007). Among
them, the family Mantellidae includes ca 230 described species (AmphibiaWeb 2021;
Frost et al. 2021), representing the most species-rich amphibian group of the island.

Mantellidae are characterized by an extraordinary ecological and morphological
diversity (Glaw and Vences 2007; Wollenberg et al. 2011; AmphibiaWeb 2021) and
are subdivided into three subfamilies: Laliostominae with an overall low species di-
versity, including the genera Laliostoma Glaw, Vences et Bohme, 1998 (1 species) and
Aglyptodactylus Boulenger, 1919 (6 species); Boophinae, a species-rich clade of about
80 described species of tree frogs, all belonging to the genus Boophis Tschudi, 1838,
and Mantellinae, which is by far the most species-rich group including nine genera
and more than 140 described species (Glaw and Vences 2007; AmphibiaWeb 2021).

The last three decades have seen the flourishing of the use of molecular techniques,
with numerous taxonomic and systematic studies that clarified the relationships among
the major groups within this subfamily (Glaw et al. 1998; Vences et al. 1998; Richards
et al. 2000; Glaw and Vences 2006; Wollenberg et al. 2011; Kaffenberger et al. 2012).
Similarly, these tools have been used in the identification of candidate species (Vieites
et al. 2009; Perl et al. 2014) and have later contributed to the formal description of
many of them (e.g. Andreone et al. 2003; Crottini et al. 2011a; Cocca et al. 2020;
AmphibiaWeb 2021).

However, in contrast to the fast-growing amount of molecular data on Mantel-
lidae, the available chromosomal data remain limited, leaving the karyological diver-
sification of the family mostly unexplored. In particular, available cytogenetic data on
the subfamily Mantellinae, obtained using different methods, come from a handful of
studies (Morescalchi 1967; Blommers-Schlésser 1978; Pintak et al. 1998; Odierna et

Comparative cytogenetics on Mantellinae 2

al. 2001; Andreone et al. 2003), together providing the description of the karyotype of
ca. 40 species. These studies revealed the occurrence of a conserved chromosome num-
ber in most genera (2n = 26), but a marked difference in chromosome morphology,
location of NORs and heterochromatin distribution (see Odierna et al. 2001 and An-
dreone et al. 2003). Differences in chromosome number (2n = 24) were also identified,
with five species of the subgenus Brygoomantis all sharing this state, thus suggesting
that the state of 2n = 24 is a derived feature of the group (Blommers-Schlésser 1978).

Comparative cytogenetics, especially when linked to phylogenetic inference, of-
fers the possibility to identify plesio- and apomorphic states, and recognizes different
evolutionary lineages (see e.g. Mezzasalma et al. 2013, 2014, 2017a). However, both
the limited taxon sampling and the outdated taxonomy used in most previous works
limited the possibility to draw robust comparisons and consistent hypotheses on the
evolution of chromosomal diversification in the subfamily.

In this study we performed a comparative cytogenetic analysis on eight mantellid
species belonging to the genera Gephyromantis Methuen, 1920, Mantidactylus Bou-
lenger, 1895 (subgenera Chonomantis, Brygoomantis and Hylobatrachus) and Spinoman-
tis Dubois, 1992, using a combination of standard coloration and banding methods.
We coupled cytogenetic analyses with the molecular taxonomic identification of the
samples and synthesized previously available information on this subfamily to produce
an overview of their chromosomal diversity. This, enable us to propose a hypothesis on
the chromosome diversification in mantelline frogs.

Material and methods

Sampling

We studied 13 samples of eight mantelline species belonging to the genera Gephyro-
mantis, Mantidactylus (subgenera Chonomantis, Brygoomantis and Hylobatrachus) and
Spinomantis. These samples were collected between 1999 and 2004 and conserved as
cell suspensions at the University of Naples Federico II.

The list of samples used in this study is provided in Table 1. To provide an over-
view of the chromosomal data on Malagasy mantelline frogs, we reviewed previously
published karyotypes of the subfamily. A complete list of all the considered taxa and
karyotypes is provided in Table 2.

Molecular taxonomic identification

DNA was extracted from cell suspensions following Sambrook (1989). A 3’ fragment
of ca. 550 bp of the mitochondrial 16S rRNA gene was amplified using the primer
pair 16Sa (CGCCTGTTTATCAAAAACAT) and 16Sb (CCGGTCTGAAACTCA-
GATCAGT) (Palumbi et al. 1991). This marker proved to be suitable for amphibian
identification (Vences et al. 2005) and has been widely used for Malagasy amphib-

4 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

Table |. Specimens analysed in this study. MRSN = Museo Regionale di Storia Naturale (Turin, Italy);
ZMA = Zoological Museum Amsterdam (Amsterdam, Netherlands); FN and FAZC, field numbers of Franco
Andreone; GA field numbers of Gennaro Aprea; FG/MYV, field numbers of Frank Glaw and Miguel Vences.

Species Field Number Sex Locality

Gephyromantis striatus MRSN A1988 female Ambatoledama Corridor: Beanjada
(FN 7645)

Gephyromantis sp. Cal9 MRSN A2109 male Ambatoledama Corridor: Beanjada
(FN 7630)

Gephyromantis sp. Cal9 MRSN A2075 male Ambatoledama Corridor: Andasin’i
(FN 7903) Governera

Gephyromantis sp. Cal9 MRSN A2112 male Ambatoledama Corridor: Andasin‘i
(FN 7890) Governera

Gephyromantis sp. Ca19 MRSN A2108 female Ambatoledama Corridor: Beanjada
(FN 7566)

Mantidactylus (Brygoomantis) alutus (Peracca, 1893) MRSN A3639 female Ankaratra: Manjakatompo
(FN 7945)

Mantidactylus (Chonomantis) sp. Ca11 MRSN A3708 male Ambatoledama Corridor: Beanjada
(FN 7545)

Mantidactylus (Hylobatrachus) cowanii (Boulenger, MRSN A2612 female Antoetra: Soamazaka

1882) (FAZC 11370)

Mantidactylus (Hylobatrachus) cowanii GA 720 male Mandraka

Spinomantis prope aglavei “North” (Methuen et MRSN A3563 male Ambatoledama Corridor: Beanjada

Hewitt, 1913) (FN 7543)

Spinomantis phantasticus (Glaw et Vences, 1997) ZMA 19627 male Vohidrazana

(FG/MV 2002-970)

Spinomantis sp. Ca3 MRSN A3998 male Ambatoledama Corridor: Beanjada
(FN 7567)

Spinomantis sp. Ca3 MRSN A3999 male Ambatoledama Corridor: Beanjada
(FN 7629)

ians (e.g. Vieites et al. 2009; Rosa et al. 2012; Crottini et al. 2011b, 2014; Penny et
al. 2017). Amplification conditions were: initial denaturation at 94 °C for 5 min, 36
cycles at 94 °C for 30 s, 50 °C for 45s and 72 °C for 45 s, followed by a final step at
72°C for 7 min. Amplicons were sequenced on an automated sequencer ABI 377 (Ap-
plied Biosystems, Foster City, CA, USA) using BigDye Terminator 3.1 (ABI). Chro-
matograms were checked and edited using Chromas Lite 2.6.6 and BioEdit 7.2.6.1
(Hall 1999). All newly determined sequences were deposited in GenBank (accession
numbers: OL830846—OL830858). For taxonomic attribution we compared newly
generated sequences with a curated database of reference sequences of the 3’ terminus
of the 16S gene for all lineages of Malagasy mantellid frogs (Cocca 2020). Taxonomic
attribution was performed using a local BLAST analysis against this reference database.

Chromosomal analysis

Cell suspensions were obtained from tissue samples as described in Mezzasalma et al.
(2013). In brief, tissues were incubated for 30 min in hypotonic solution (KCI 0.075
M + sodium citrate 0.5%, 1:1) and fixed for 15 min in methanol-acetic acid, 3:1.
Fixed tissues were stored at 4 °C and dissociated manually on a steel sieve. Chromo-
somes were obtained using the air-drying method and stained with conventional col-

Comparative cytogenetics on Mantellinae

Table 2. Available karyological data on mantelline frogs. M = metacentric pairs; sm = submetacentric

pairs; st = subtelocentric pairs; t = telocentric pairs; AN = arm number; [#] = NOR bearing chromosome
pair; CB = C-banding; F = Fluorochrome; R = references; (1) = Morescalchi (1967); (2) = Blommers-
Schlosser (1978); (3) = Pintak et al. (1998); (4) = Odierna et al. (2001); (5) = Andreone et al. (2003); (6)
= this study. Nomenclature follows Vieites et al. (2009), updated in Perl et al. (2014).

Genus/subgenus

Species

Mantella Boulenger, aurantiaca Mocquard, 1900

1882

Blommersia Dubois,

1992

Gephyromantis
Asperomantis
Duboimantis
Duboimantis
Duboimantis
Duboimantis
Duboimantis
Duboimantis
Duboimantis

Duboimantis

Duboimantis

Laurentomantis

Phylacomantis
Guibemanitis
Dubois, 1992
Guibemantis
Guibemantis
Pandanusicola
Pandanusicola
Pandanusicola

Pandanusicola

aurantiaca

haraldmeieri Busse, 1981

ebenaui (Boettger, 1880)
aurantiaca

crocea Pintak et Bohme, 1990
baroni Boulenger, 1888
haraldmeieri

ebenaui

viridis Pintak et Bohme, 1988
laevigata Methuen et Hewitt, 1913
baroni

ebenaui

betsileo (Grandidier, 1872)

cowanit

expectata Busse et Bohme, 1992
laevigata

madagascariensis (Grandidier, 1872)
nigricans Guibé, 1978

pulchra Parker, 1925

viridis

aurantiaca

blommersae (Guibé 1975)

galani Vences, Kéhler, Pabijan, et Glaw 2010
grandisonae (Guibé, 1974)

asper (Boulenger, 1882)

granulatus (Boettger, 1881)

leucomaculatus (Guibé, 1975)

luteus (Methuen et Hewitt, 1913)

prope /uteus Methuen et Hewitt, 1913
prope moseri “Masoala” Glaw et Vences, 2002
sp. Cal9

redimitus (Boulenger, 1889)

salegy (Andreone, Aprea, Vences et Odierna,
2003)

zavona (Vences, Andreone, Glaw et
Randrianirina, 2003)

striatus

pseudoasper (Guibé, 1974)

depressiceps (Boulenger, 1882)
timidus (Vences et Glaw, 2005)
methueni (Angel, 1929)
bicalcaratus (Boettger, 1913)

prope bicalcaratus (Boettger, 1913)
liber (Peracca, 1893)

Karyotype
2n = 26 10m 3sm; AN = 52
2n = 26 10m 3sm; AN = 52
2n = 26 9m 4sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 1sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m Ism; Ist AN = 52
2n = 26 10m 2sm; 1t AN = 48
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 12m Ism; AN = 52
2n = 26 12m Ism; AN = 52
2n = 26 10m 3sm; AN = 52

2n = 26 6m 3sm 4t; AN = 44
2n = 26 8m 4sm 1t; AN050
2n = 26 6m 6sm It; AN = 50
2n = 26 6m 4sm Ist 2t; AN = 48
2n = 26 6m 2sm Ist 4t; AN = 42
2n = 26 6m 6sm It; AN = 52
2n = 26 8m 5sm; AN = 52
2n = 26 7m 5sm It; AN = 50
2n = 26 5m 7sm Ist; AN = 52

2n = 26 9m 4sm; AN = 52

2n = 24 6m 1Ism 5t; AN = 38
2n = 26 7m 7sm; AN = 52

2n = 26 10m 3sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 11m 2sm; AN = 52
2n = 26 9m 4sm; AN = 52
2n = 26 11m 2sm; AN = 52

Banding

Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N
Ag-N

Ag-NOR [1], CB, F
Ag-NOR [8], CB, F
Ag-NOR [6], CB, F
Ag-NOR [11], CB, F
Ag-NOR [6], CB, F
Ag-NOR [6], CB, F
Ag-NOR [6], CB, F

Ag-NOR [6], CB, F

Ag-NOR [10], CB, F
Ag-NOR [9], CB, F

Ag-NOR [1], CB, F

CB
CB
CB
CB
CB
CB
CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB
OR [2], CB

R
(1)
(2)
(2)
(2)
(3)
(3)
(3)
(3)
(3)
(3)
(3)
(4)
(4)
(4)
(4)
(4)
(4)
(4)
(4)
(4)
(4)
(4)
(2)
(2)
(5)

(2)
(5)
(5)
(2)
(5)
(5)
(6)
(5)
(5)

(5)

(6)
(5)

(2)
(2)
(2)
(4)
(2)
(2)

6 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)
Genus/subgenus Species Karyotype Banding R
Pandanusicola pulcher (Boulenger, 1882) 2n = 26 9m 4sm; AN = 52 (2)
Pandanusicola prope punctatus (Blommers-Schlésser, 1979) 2n = 26 10m 3sm; AN = 52 Ag-NOR [1], CB, F (4)
Pandanusicola punctatus (Blommers-Schlésser, 1979) 2n = 26 9m 4sm; AN = 52 (2)
Mantidactylus
Brygoomantis alutus 2n = 24 12m; AN = 48 Ag-NOR [6], CB, F (6)
Brygoomantis ambohimitombi Boulenger 1918 2n = 24 9m 3sm; AN = 48 (2)
Brygoomantis betsileanus (Boulenger, 1882) 2n = 24 5m 6sm It; AN = 46 (2)
Brygoomantis prope biporus (Boulenger, 1889 2n = 24 8m 4sm; AN = 48 (2)
Brygoomantis sp. Cal9 2n = 24 7m 5sm; AN = 48 (2)
Brygoomantis prope ulcerosus (Boettger, 1880) 2n = 24 8m 2sm Ist 1t; AN = 46 (2)
Chonomantis prope aerumnalis (Peracca, 1893) 2n = 26 10m 2sm It; AN = 50 (2)
Chonomantis sp. Call 2n = 26 10m 2sm 2t; AN = 50 (6)
Chonomantis paidroa Bora, Ramilijaona, Raminosoa et 2n = 26 6m 7sm; AN = 52 (2)
Vences, 2011
Hylobatrachus cowanii (Boulenger, 1882) 2n = 26 12m 1t; AN = 50 Ag-NOR [6], CB, F (6)
Hylobatrachus lugubris (Duméril, 1853) 2n = 26 9m 3sm 1t; AN = 50 (2)
Mantidactylus guttulatus (Boulenger, 1881) 2n = 26 11m 2sm; AN = 52 (2)
Ochthomantis prope femoralis (Boulenger, 1882) 2n = 26 9m 3sm It; AN = 50 (2)
Spinomantis (2)
aglavei (Methuen et Hewitt, 1913) 2n = 24 9m 3sm; AN = 48 (2)

prope aglavei “North” 2n = 24 10m 2sm; AN = 48 Ag-NOR [7], CB, F (6)
peraccae (Boulenger, 1896) 2n = 26 7m 6sm; AN = 48 (2)
phantasticus 2n = 26 13m; AN = 52 (6)
sp. Ca3 2n = 26 12m 1sm: AN = 52 Ag-NOR [6], CB, F_ (6)

orations (5% Giemsa solution at pH 7), Ag-NOR staining (Howell and Black 1980),
C-banding according to Sumner (1972) and sequential C-banding + Fluorochromes
(CMA+DAPI) following Mezzasalma et al. (2015). Ag-NOR and C-banding staining
were not performed on M. sp. Call and S. phantasticus, because quantity and qual-
ity of metaphase plates were not adequate for additional staining methods. Karyotype
reconstruction was performed using at least five plates per sample.

Results

Molecular taxonomic identification

The selected 16S fragment was successfully amplified and sequenced from all analysed
samples. All newly generated sequences showed identity scores > 97% with homologous
sequences available in the mantellid frogs database generated in Cocca (2020). We followed
the nomenclature used in Vieites et al. (2009), updated in Perl et al. (2014) (see Table 1).

Cytogenetic analysis

The studied specimen of Gephyromantis striatus, Mantidactylus (Brygoomantis) alutus
and Spinomantis prope aglavei “North” have a karyotype of 2n = 24 chromosomes,
with the first six pairs distinctively larger than the other six pairs (Fig. 1; Table 3). In

Comparative cytogenetics on Mantellinae 7

6 7 8 9 10 11 12 13

CTU TUUE UG Mb mt oe ax oe EE
Bi 48 ab Re lel ee an sp as as ou
7) 1)
(Sip) eee ah edt teh sede ds

Ce BG G8 GR Bs ct ae ce cs 00 os ot ot
F t} HT i ut Hi | ee) ee ss ss an ss

a), yi ik TH K¢ 7 AEBS 8 RR aK BR oR

mt nh sh V¢ aX tS kh BR OKR OR ORK ax Ka

10 um

Cc

Figure |. Giemsa stained karyotypes of A Gephyromantis striatus (FN 7645) B Mantidactylus (Brygooman-
tis) alutus (FN 7945) © Spimomantis prope aglavei “North” (FN 7543) D Gephyromantis sp. Cal9 (FN
7630) E Mantidactylus (Chonomantis) sp. Cal1 (FN 7545) F Mantidactylus (Hylobatrachus) cowanti (FAZC
11370) G Spinomantis sp. Ca3 (FN 7567) and H Spinomantis phantasticus (FG/MV 2002-970). Insets rep-
resent NOR-bearing pairs stained with Giemsa (down in the insets) and Ag-NOR method (up in the insets).

G. striatus, the pairs 1-6, 8 are biarmed while the other pairs are telocentric, with the
pair 10 bearing the NOR loci (Fig. 1A; Table 3). In MZ. (Brygoomantis) alutus and S.
prope aglavei “North” all pairs are biarmed and NOR loci were detected on the 6 and
7° pair (Fig. 1B, C), respectively.

The samples of the other five species (G. sp. Cal9, M. (Chonomantis) sp. Cal1, M.
(Hylobatrachus) cowanii, S. phantasticus and S. sp. Ca3) presented a karyotype of 2n =
26 chromosomes, with the first five pairs distinctively larger than the remaining eight
pairs (Fig. 1D—H). In these species, all chromosome pairs resulted biarmed, with the
exception of M. cowanii and of M. (Chonomantis) sp. Cal1, whose karyotype showed
one (pair 12) and two pairs (10 and 12) composed of telocentric elements, respectively
(Fig. 1E, F). The sixth pair is the NOR bearing one in G. sp. Cal9, M. cowanii and S.
spr Cad (rie wes GG).

8 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

Table 3. Chromosome morphometric parameters of the study species. LR%= % Relative Length (length
of a chromosome/total chromosome length* 100); CI = centromeric index (ratio between short arm/chro-

mosome length*100). Sh = chromosome shape (m = metacentric; sm = submetacentric; t = telocentric).

Sp. G. striatus M.alutus S. prope G.sp.Cal9 M.sp Call M. cowanii S. sp. Cal11 S.
aglavei phantasticus
Chr. LR%-CI LR%-CI LR%-CI LR%-CI LR%-CI LR%-CI LR%-CI LR%-CI
(sh) (sh) (sh) (sh) (sh) (sh) (sh) (sh)
' 16.8-41.6 15.1-44.0 16.9-40.7 15.0-46.3 12.3-39.3 18.6-48.8 16.1-37.8 16.2-38.5
(m) (m) (m) (m) (m) (m) (m) (m)
‘ 12.7-36.9 11.8-48.5 14.0-32.0 13.7-35.6 12.0-34.9 12.9-42.3 14.2-42.8 13.8-30.9
(m) (m) (sm) (sm) (sm) (m) (m) (sm)
3 11.8-36.7. 11.6-34.1 12.1-26.0 12.4-40.8 11.2-43.9 12.8-37.2 12.4-38.2 11.5-34.8
(sm) (sm) (sm) (m) (m) (sm) (m) (sm)
4 10.9-39.0 10.6-41.1 11.9-34.3 11.3-42.8 11.1-38.4 11.3-40.0 12.1-30.6 —_11.4-38.5
(m) (m) (sm) (m) (m) (m) (sm) (m)
5 10.2-45.2 10.2-44.6 9.7-44.7 10.6-36.1 10.0-41.7. 19.2-44.8 9.1-36.0 = 10.4-35.1
(m) (m) (m) (sm) (m) (m) (sm) (sm)
6 9.7-48.7. 10.1-48.2 -9.7-42.6 —- 6.4-31.1 6.2-44.7 5.3-47.3. 5.5-38.2 6.2—33.2
(m) (m) (m) (sm) (m) (m) (m) (sm)
7 6.0-0 5.9-49.0 4.5-33.0 5.0-40.1 6.1-46.2 5.3-49.3 5.5-38.7 6.2-42.9
(t) (m) (m) (m) (m) (m) (m) (m)
8 5.6-39.0 5.9-41.4 4.1-47.0 4.8-29.3 6.1-41.0 4.8-49.6 5.1-39.8 5.9-44.5
(m) (m) (m) (sm) (m) (m) (m) (m)
9 5.4—0 5.8-45.8 3.9-47.0 4.4-48.8 5.9-43.8 44-344 4.9-43.9 4,448.8
(t) (m) (m) (m) (m) (sm) (m) (m)
vo 4.6-0 4.9-43.0 3.5-39.3 4.3-42.9 5.5—0 4.3-41.7 4,244.1 3.8-48.8
(t) (m) (m) (m) (t) (m) (m) (m)
ii 3.4-0 41-45.0 3.3-49.0 4.3-37.4 5.5-47.5 4.2-40.8 3.6-41.7 3.7-44.1
(t) (m) (m) (sm) (m) (m) (m) (m)
(3 2.9-0 4.0-46.3 3.1-47.4 4.2-37.4 4,2-0 4.0-0 3.4-38.0 3.5-49.6
(t) (m) (m) (sm) (t) (t) (m) (m)
B 3.6-43.5 4.1-42.6 3.8-38.2 3.2-46.1 3.0-43.8

(m) (m) (m) (m) (m)

In G. striatus, NOR associated heterochromatin was C-banding positive (CMA +
and DAPI -) and tiny centromeric C-bands were present on some chromosome pairs
(Fig. 2A, A’, A”). Mantidactylus alutus and Spimomantis prope aglavei “North” showed
centromeric and telomeric C-bands and NOR associated heterochromatin which were
positive to CMA and DAPI negative (Fig. 2B, B’, B” and C, C’, C”). Mantidacty-
lus (Brygoomantis) alutus also presented an additional bright centromeric band on the
chromosomes of pair nine. Gephyromantis sp. Cal9 showed centromeric and telomeric
C- bands, which were CMA and DAPI positive (Fig. 2D, D’, D”). Spinomantis sp. Ca3
showed solid telomeric C-bands and NOR associated heterochromatin, which resulted
CMA positive and DAPI negative (Fig. 2E, E’, E”). Mantidactylus (Hylobatrachus)
cowanii had centromeric C-bands on all chromosomes, which were CMA and DAPI
negative (Fig. 2F, F’, F”). No heteromorphic or completely heterochromatic chromo-
some were found in any of the studied samples.

Comparative cytogenetics on Mantellinae »

Figure 2. Metaphase plates of Gephyromantis striatus (A, A’, A’), Mantidactylus (Brygoomantis) alutus
(B, B’, B”), Spinomantis prope aglavei “North” (C, C’, C’’), Gephyromantis sp. Cal9 (D, D’, D”’),
Spinomantis sp. Ca3 (E, E’, E”’) and Mantidactylus (Hylobatrachus) cowanii (F, F’, F’’) stained with C-
banding + Giemsa (A=F), + CMA (A’=F’) + DAPI (A”=F’’). Arrows point at NORs while arrowheads
highlight other heterochromatin blocks.

10 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

Discussion

We here provide new karyological data on eight frog species belonging to the subfamily
Mantellinae and discuss the available chromosome data on this subfamily to provide a
first comprehensive assessment of its karyological diversity.

Available data on representatives of the other two Mantellidae subfamilies (Boo-
phininae and Laliostominae) highlight the occurrence of a conserved karyotype struc-
ture in terms of chromosome number and morphology. In particular, the first karyo-
logical studies by Blommers-Schlossers (1978) on 12 species of Boophis (Boophininae)
and on Aglyptodactylus madagascariensis (Duméril, 1853) (Laliostominae) revealed a
conserved karyotype of 2n = 26 with all biarmed chromosomes.

Following studies by Aprea et al. (1998, 2004) expanded the knowledge on the
karyological uniformity to the position of NORs loci, invariably on the sixth chromo-
some pair both in Boophis and A. madagascariensis, but evidenced different patterns of
heterochromatin composition and distribution. Similar karyological characters were
described also in different species of the genus Mantella (belonging to the subfam-
ily Mantellinae), all showing a karyotype of 2n = 26 with all biarmed chromosomes
(Blommers-Schléssers 1978; Odierna et al. 2001). A karyotype of 2n = 26 with all bi-
armed elements should thus be considered the primitive condition in the whole family
Mantellidae, as it is highly conserved in all subfamilies, genera and most subgenera (see
Blommers-Schlésser 1978; Aprea et al. 1998, 2004; Odierna et al. 2001, see Table 2).
Nevertheless, species of other genera of the subfamily Mantellinae show a wider karyo-
logical variability, both concerning chromosomes number, morphology, localizations
of NORs loci and heterochromatin composition and distribution (Blommers-Schléss-
er 1978; Odierna et al. 2001; present study) (see also Table 2).

Primitive n = 13 (2n = 26) karyotype

sielatet tt Fe

Inversions { |
2 Tandem
os
fusion

Ga BBR

Figure 3. Hypothesized general model of chromosome reduction in Mantellinae from n = 13 (2n = 26)
to n = 12 (2n = 24) by means of chromosome fusions. Red dots highlight the NOR bearing chromosome.

Comparative cytogenetics on Mantellinae vat

Concerning the variability of the chromosome number, a 2n = 26 karyotype is still
the most common chromosomal configuration, but karyotypes with a reduced chro-
mosome complement (2n = 24) have been documented in 9 species of three different
genera (6 species of Mantidactylus (subgenus Brygoomantis), 2. Spinomantis and Gephy-
romantis striatus) (See Fig. 1 and Table 2). Furthermore, while the 2n = 26 configura-
tion occurs in all three subfamilies of the family Mantellidae (Mantellinae, Boophinae
and Laliostominae) (e.g. Aprea et al. 1998, 2004; present study), karyotypes with 2n =
24 seem to occur in just a few phylogenetically lineages (genus Gephyromantis, Manti-
dactylus and Spinomantis), where the 2n = 26 configuration is also present (Blommers-
Schlésser 1978; present study). In turn, the subfamily Boophinae, with all the species
showing a 2n = 26 karyotype (Aprea et al. 1998, 2004), has been depicted as a basal
group in the Mantellidae radiation (see e.g. Wollenberg et al. 2011). These evidences
suggest that a reduction of the chromosome number from 2n = 26 to 2n = 24 occurred
repeatedly and independently in different lineages of the subfamily Mantellinae, prob-
ably involving chromosome inversions and a fusion (translocation) between two ele-
ments of the smallest pairs (6-13), giving rise to an additional large (6") chromosome
pair in several species (e.g. G. striatus, M. (Brygoomantis) alutus, and S. prope aglavei
“North”) (Fig. 3; Table 3). Interestingly, a similar reduction of the chromosome num-
ber driven by tandem fusions (from 2n = 26 to 24) has been documented also in the
family Ranidae (Miura et al. 1995).

Other than tandem fusions, chromosome inversions of primitive biarmed ele-
ments also had a significant role in the morphological chromosome diversity observed
in mantelline frogs. These mechanisms generated a variable number of telocentric ele-
ments in different evolutionary lineages (see Figs 1, 3 and Table 2).

Considering the position of the loci of NORs, our results and available literature
data (Aprea et al. 1998, 2004; Odierna et al. 2001; Andreone et al. 2003), show that
NORs occurrence on the sixth chromosome pair can be considered a primitive state, as
it is described for all analysed species belonging to the genus Boophis, A. madascarien-
sis and most Gephyromantis, Mantidactylus (subgenus Brygoomantis), and. Spinomantis.
On the other hand, a derivate configuration of NOR loci seems to have emerged
multiple times in distinct lineages. The different positions of NOR loci in mantelline
frogs suggest that these elements were also differently involved in the hypothesized
chromosome fusions from 2n = 26 to 2n = 24, providing further support to multiple,
independent rearrangements leading to similar karyotype configurations. In fact, while
in M. (Brygoomantis) alutus the sixth large chromosome pair likely derived from a fu-
sion involving the primitive NOR bearing pair and another smaller pair, in G. striatus
and S. prope aglavei “North” the pair 6 does not include NOR loci, which are found
on the 7 and 10" chromosome pair, respectively (see Fig. 1). In other species of Ge-
phyromantis, Blommersia, Guibemantis and Mantella the relocation of NORs involved
different pairs (1%, 24, 8°, 9, 10" or 11") (Odierna et al. 2001; Andreone et al. 2003;
this study). It should be noted that Ag-NOR staining only evidences active NORs, and
the existence of different inactive sites in the karyotypes of the studied species cannot
be excluded based only on this analysis. However, we found correspondence in NOR

12 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

location using both Ag-NOR and C-banding + CMA (in Figs 1, 2), which also has the
power to uncover rDNA clusters (Schmid 1982; Zalesna et al. 2017).

Various mechanisms may be responsible for NOR relocation, such as cryptic struc-
tural rearrangements, minute insertions, reintegration of rDNA genes amplified dur-
ing ovogonial auxocytosis or the activation of silent sites (Nardi et al. 1977; Schmid
1978; King 1980; Mahony and Robinson 1986; Schmid and Guttenbach 1988; Mez-
zasalma et al. 2018). These mechanisms may be independent to other rearrangements,
despite the resulting change in the configuration of NORs is a significant indicator of
lineage divergence at different taxonomic level (e.g. Pardo et al. 2001; Mezzasalma et
al. 2015, 2018, 2021).

Sequential C-banding did not evidence the occurrence of any sex-specific, largely
heterochromatic chromosomes (generally related to differentiated heterogametic sex
chromosomes, a condition not yet documented in the family Mantellidae), B chro-
mosomes, or interchromosomal rearrangements leading to heteromorphic autosome
pairs (e.g. Mezzasalma et al. 2014, 2016, 2017b; Sidhom et al. 2020). Nevertheless,
C-banding showed a heterogeneous heterochromatin distribution in Mantellidae (see
also Aprea et al. 1998, 2004; Odierna et al. 2001; Andreone et al. 2003), high-
lighting the occurrence of species-specific banding patterns. For example, G. striatus
and M. (Hylobatrachus) cowanii show different amount and location of C-banding
positive heterochromatin in comparison with closely related species with the same
chromosome number and similar morphology (e.g. G. sp. Cal9 and M. (Brygooman-
tis) alutus). Interspecific variations in heterochromatin are generally due to different
levels of amplification of highly repetitive DNA (Charlesworth et al. 1994). These
differences mostly occurred without modifications of the chromosome morphology
in Mantellidae (see also Aprea et al. 1998, 2004; Odierna et al. 2001; Andreone et
al. 2003), probably by means of symmetrical addition/deletion of heterochromatin.
The occurrence of distinctive species-specific banding patterns may be useful in evo-
lutionary cytogenetic and cytotaxonomic studies in the subfamily, but comprehensive
comparative analyses would benefit from more banding data on species of different
genera and subgenera.

Finally, we also highlight the importance of a preliminary molecular taxonomic
identification of mantellid frogs for a consistent karyotype attribution, and that fu-
ture cytogenetic studies should focus on Laliostoma Glaw et al., 1998, Wakea Glaw et
Vences, 2006, Boehmantis Glaw et Vences, 2006 and Tsingymantis Glaw et al., 2006, as
well as on different undersampled genera and subgenera.

Conclusions

We provide new chromosomal data on eight species belonging to the subfamily Man-
tellinae, advancing the knowledge on their karyotype diversity, and suggesting that
a reduction in the chromosome number and the relocation of NORs loci occurred
repeatedly and independently in different genera of this subfamily. We hypothesize a

Comparative cytogenetics on Mantellinae L3

karyotype of 2n = 26 with all biarmed elements and loci of NORs on the 6" chromo-
some pair as the ancestral state in the whole family Mantellidae and propose a model
for the reduction of the chromosome number from 2n = 26 to 2n = 24 by means of
tandem fusions.

Acknowledgements

We are grateful to Malagasy authorities for granting research and export permits. Nu-
merous colleagues helped us in the field: Gennaro Aprea, Frank Glaw, Miguel Vences.
Portuguese National Funds through FCT (Foundation for Science and Technology)
support the 2020.00823.CEECIND/CP1601/CT0003 contract to AC and the IC-
ETA 2020-37 contract to MM. This work was supported by National Funds through
FCT under the PTDC/BIA-EVL/31254/2017 project.

References

AmphibiaWeb (2021) University of California, Berkeley, CA, USA. https://amphibiaweb.org
[Last Accessed 01 March 2021]

Andreone F, Aprea G, Vences M, Odierna G (2003) A new frog of the genus Mantidactylus
from the rainforests of north-eastern Madagascar, and its karyological affinities. Amphibia-
Reptilia 24(3): 285-303. https://doi.org/10.1163/156853803322440763

Andreone F, Rosa GM, Noél J, Crottini A, Vences M, Raxworthy CJ (2010) Living within
dry palm leaves: the discovery of an unknown Blommersia (Mantellidae: Anura) reveals a
new reproductive strategy in the amphibians of Madagascar. Naturwissenschaften 97(6):
525-543. https://doi.org/10.1007/s00114-010-0667-x

Aprea G, Andreone F, Capriglione T, Odierna G (1998) Chromosome banding in several Mala-
gasy anuran species belonging to the genera Aglyptodactylus, Boophis and Mantidactylus.
Abstracts of the 9 Ordinary General Meeting of the Societas Herpetologica Europaea.
Chambery, August 25—29, 1998, Chambéry, 21-21.

Aprea G, Andreone F, Capriglione T, Odierna G, Vences M (2004) Evidence for a remarkable
stasis of chromosome evolution in Malagasy treefrogs (Boophis, Mantellidae). Italian Jour-
nal of Zoology 71(2): 237-244. https://doi.org/10.1080/11250000409356641

Blommers-Schlésser RMA (1978) Cytotaxonomy of the Ranidae, Rhacophoridae, Hyperolii-
dae (Anura) from Madagascar with a note on the karyotype of two amphibians of the
Seychelles. Genetica 48(1): 23—40. https://doi.org/10.137 1/journal.pbio.0060118

Charlesworth B, Sniegowski P, Stephan W (1994) The evolutionary dynamics of repetitive
DNA in eukaryotes. Nature 371: 215-220. https://doi.org/10.1038/371215a0

Cocca W (2020) Studying the processes of species diversification using the adaptive radia-
tion of the mantellid frogs of Madagascar (Anura: Mantellidae) as a model system. Ph.D.
Dissertation, Porto, Portugal, University of Porto. https://repositorio-aberto.up.pt/
handle/10216/130002?locale=en

14 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

Cocca W, Andreone F, Belluardo FE, Rosa GM, Randrianirina JE, Glaw F, Crottini A (2020)
Resolving a taxonomic and nomenclatural puzzle in mantellid frogs: synonymization
of Gephyromantis azzurrae with G. corvus, and description of Gephyromantis kintana sp.
nov. from the Isalo Massif, western Madagascar. ZooKeys 951: 133-157. https://doi.
org/10.3897/zookeys.951.51129

Crottini A, Glaw F, Casiraghi M, Jenkins RKB, Mercurio V, Randrianantoandro JC, Randri-
anirina JE, Andreone F (2011a) A new Gephyromantis (Phylacomantis) frog species from
the pinnacle karst of Bemaraha, western Madagascar. ZooKeys 81: 51-71. https://doi.
org/10.3897/zookeys.81.1111

Crottini A, Barbuto M, Casiraghi M, Andreone (2011b) A rapid amphibian survey at Itremo-
Ambatofinandrahana, central Madagascar, with confirmed absence of chytrid fungus and
recommendations for future monitoring activities. North-Western Journal of Zoology
7(2): 346-351. http://biozoojournals.ro/nwjz/content/v7n2/nwjz.111214.Crottini.pdf

Crottini A, Bollen A, Weldon C, Dalton DL, Kotze A, Noél J, Iambana B, Andreone F (2014)
Amphibian survey and current absence of Batrachochytrium dendrobatidis (Bd) in Ivoloi-
na Park, Toamasina (eastern Madagascar). African Journal of Herpetology 63(1): 70-78.
https://doi.org/10.1080/21564574.2013.833994

Frost DR (2021) Amphibian species of the world: an online reference. Version 6.1. Electronic
Database accessible at https://amphibiansoftheworld.amnh.org/index.php. American Mu-
seum of Natural History, New York, USA. https://doi.org/10.5531/db.vz.0001

Ganzhorn JU, Lowry II PP, Schatz GE, Somme S (2001) The biodiversity of Madagascar:
one of the world’s hottest hotspots on its way out. Oryx 35(4): 346-348. https://doi.
org/10.1046/j.1365-3008.2001.00201.x

Glaw F, Vences M (2006) Phylogeny and genus-level classification of mantellid frogs (Amphib-
ia, Anura). Organisms, Diversity and Evolution 6(3): 236-253. https://doi.org/10.1016/j.
ode.2005.12.001

Glaw FE, Vences M (2007) A Field Guide to the Amphibians and Reptiles of Madagascar. 3"
edn. Vences M and Glaw F, Verlags GbR, Koln, 496 pp.

Glaw F, Vences M, Bohme W (1998) Systematic revision of the genus Aglyptodactylus Bou-
lenger, 1919 (Amphibia: Ranidae), and analysis of its phylogenetic relationships to other
Madagascan ranid genera (Jomopterna, Boophis, Mantidactylus, and Mantella). Jour-
nal of Zoological Systematics and Evolutionary Research 36(1—2): 17-37. https://doi.
org/10.1111/j.1439-0469.1998.tb00775.x

Howell WM, Black DA (1980) Controlled silver staining of nucleolus organizer regions with
a protective colloidal developer: a 1 step method. Experientia 36(8): 1014-1015. https://
doi.org/10.1007/BF01953855

Kaffenberger N, Wollenberg KC, Kohler J, Glaw FE, Vieites DR, Vences M (2012) Molecular
phylogeny and biogeography of Malagasy frogs of the genus Gephyromantis. Molecular Phy-
logenetics and Evolution 62(1): 555-560. https://doi.org/10.1016/j.ympev.2011.09.023

King M (1980) C-banding studies on Australian hylid frogs: Secondary constriction structure
and the concept of euchromatin transformation. Chromosoma 80(2): 191-217. https://
doi.org/10.1007/BF00286300

Comparative cytogenetics on Mantellinae 15

Mahony MJ, Robinson ES (1986) Nucleolar organiser region (NOR) location in karyotypes of
Australian ground frogs (Family Myobatrachidae). Genetica 68(2): 119-127. https://doi.
org/10.1007/BF02424409

Mezzasalma M, Andreone F, Aprea G, Glaw EK, Odierna G, Guarino FM (2017a) Molecular
phylogeny, biogeography and chromosome evolution of Malagasy dwarf geckos of the ge-
nus Lygodactylus (Squamata, Gekkonidae). Zoologica Scripta 46(1): 42-54. https://doi.
org/10.1111/zsc.12188

Mezzasalma M, Andreone F, Aprea G, Glaw F, Odierna G, Guarino FM (2017b) When
can chromosomes drive speciation? The peculiar case of the Malagasy tomato frogs
(genus Dyscophus). Zoologischer Anzeiger 268: 41-46. https://doi.org/10.1016/j.
jcz.2017.04.006

Mezzasalma M, Andreone F, Branch WR, Glaw F, Guarino FM, Nagy ZT, Odierna G, Aprea
G (2014) Chromosome evolution in pseudoxyrhophiine snakes from Madagascar: a wide
range of karyotypic variability. Biological Journal of Linnean Society London 112(3): 450-
460. https://doi.org/10.1111/bij.12280

Mezzasalma M, Andreone F, Glaw F, Petraccioli A, Odierna G, Guarino FM (2016) A kar-
yological study of three typhlopid species with some inferences on chromosome evolu-
tion in blindsnakes (Scolecophidia). Zoologischer Anzeiger 264: 34-40. https://doi.
org/10.1016/j.jcz.2016.07.001

Mezzasalma M, Andreone F, Glaw F, Odierna G, Petraccioli A, Guarino FM (2018) Chromo-
some aneupolyploidy in an endemic Malagasy gecko (Gekkonidae: Geckolepis). Salaman-
dra 54(1): 56-62. http://www.salamandra-journal.com

Mezzasalma M, Andreone F, Glaw F, Guarino FM, Odierna G, Petraccioli A, Picariello O
(2019) Changes in heterochromatin content and ancient chromosome fusion in the en-
demic Malagasy boid snakes Sanzinia and Acrantophis (Squamata: Serpentes). Salamandra
55(2): 140-144. http://www.salamandra-journal.com

Mezzasalma M, Glaw F, Odierna G, Petraccioli A, Guarino FM (2015) Karyological analyses
of Pseudhymenochirus merlini and Hymenochirus boettgeri provide new insights into the
chromosome evolution in the anuran family Pipidae. Zoologischer Anzeiger 258: 47-53.
https://doi.org/10.1016/j.jcz.2015.07.001

Mezzasalma M, Guarino FM, Aprea G, Petraccioli A, Crottini A, Odierna G (2013) Karyo-
logical evidence for diversification of Italian slow worm populations (Squamata, Angui-
dae). Comparative Cytogenetics 7(3): 217-227. https://doi.org/10.3897/compcytogen.
v7i3.5398

Mezzasalma M, Odierna G, Petraccioli A, Veith M, Guarino FM (2021) Karyological diver-
sification in the genus Lyciasalamandra (Urodela: Salamandridae). Animals 11(6): 1709.
https://doi.org/10.3390/anil 1061709

Miura I, Nishioka M, Borkin LJ, Wu Z (1995) The origin of the brown frogs with 2n = 24
chromosomes. Experientia 51(2): 179-188. https://doi.org/10.1007/BF01929366

Morescalchi A (1967) Le relazioni tra il cariotipo di anuri diplasioceli: 1. [1 corredo cromo-
somico di alcuni Ranidae. Caryologia 20(1): 65-85. https://doi.org/10.1080/00087114.
1967.10796248

16 Marcello Mezzasalma et al. / Comparative Cytogenetics 16(1): 1-17 (2022)

Myers N, Mittermeier RA, Mittermeier CG, da Fonseca GAB, Kent J (2000) Biodiver-
sity hot-spots for conservation priorities. Nature 403(6772): 853-858. https://doi.
org/10.1038/35002501

Nardi I, Barsacchi-Pilone G, Batistoni R, Andronico F (1977) Chromosome location of the ri-
bosomal RNA genes in Triturus vulgaris meridionalis (Amphibia, Urodela). II. Intraspecific
variability in number and position of the chromosome for 18S and 28S ribosomal RNA.
Chromosoma 64(1): 67—84. https://doi.org/10.1007/BF00292889

Odierna G, Vences M, Aprea G, Létters S$, Andreone F (2001) Chromosome data for Malagasy
poison frogs (Amphibia: Ranidae: Mantella) and their bearing on taxonomy and phylog-
eny. Zoological Science 18(4): 505-514. https://doi.org/10.2108/zsj.18.505

Palumbi SR, Martin A, Romano S, Mcmillan WO, Stice L, Grabowski G (1991) The Simple
Fool’s Guide to PCR, Version 2.0. Privately published, University of Hawaii.

Pardo BG, Bouza C, Castro J, Martinez P, Sanchez L (2001) Localization of ribosomal genes
in Pleuronectiformes using Ag-, CMA,-banding and in situ hybridization. Heredity 86(5):
531-536. hetps://doi.org/10.1046/}.1365-2540.2001.00802.x

Penny SG, Crottini A, Andreone E Bellati A, Rakotozafy LMS, Holderied MW, Schwitzer
C, Rosa GM (2017) Combining old and new evidence to increase the known biodiver-
sity value of the Sahamalaza Peninsula, Northwest Madagascar. Contribution to Zoology
86(4): 273-296. https://doi.org/10.1163/18759866-08604002

Perl RGB, Nagy ZT, Sonet G, Glaw FE Wollenberg KC, Vences M (2014) DNA barcod-
ing Madagascar’s amphibian fauna. Amphibia-Reptilia 35(2): 197-206. https://doi.
org/10.1163/15685381-00002942

Pintak T, Vences M, Glaw F, Bohme W (1998) Comparative chromosome morphology of
Malagasy poison frogs (Amphibia: Ranidae: Mantella). Folia Zoologica 47(3): 197-204.

Richards CM, Nussbaum RA, Raxworthy CJ (2000) Phylogenetic relationships within the Mad-
agascan boophids and mantellids as elucidated by mitochondrial ribosomal genes. African
Journal of Herpetology 49(1): 23-32. https://doi.org/10.1080/21564574.2000.9650013

Rosa GM, Andreone F, Crottini A, Hauswaldt JS, Noél J, Rabibisoa NH, Randriambahini-
arime MO, Rebelo R, Raxworthy CJ (2012) The amphibians of the relict Betampona
low-elevation rainforest, eastern Madagascar: an application of the integrative taxonomy
approach to biodiversity assessments. Biodiversity and Conservation 21(6): 1531-1559.
https://doi.org/10.1007/s10531-012-0262-x

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, 2"¢ edn.
Cold Spring Harbor Lab Press, New York.

Schmid M (1978) Chromosome banding in Amphibia. II. Constitutive heterochromatin and
nucleolar organizer regions in Ranidae, Microhylidae and Rhacophoridae. Chromosoma
77: 83-103. https://doi.org/10.1007/BF00287145

Schmid M (1982) Chromosome Banding in Amphibia VII. Analysis of the Structure and
Variability of NORs in Anura. Chromosoma 87: 327-344. https://doi.org/10.1007/
BF00327634

Schmid M, Guttenbach M (1988) Evolutionary diversity of reverse (R) fluorescent chro-
mosome bands in vertebrates. Chromosoma 97(2): 101-114. https://doi.org/10.1007/
BF00327367

Comparative cytogenetics on Mantellinae ie

Sidhom M, Said K, Chatti N, Guarino FM, Odierna G, Petraccioli A, Picariello O, Mez-
zasalma M (2020) Karyological characterization of the common chameleon (Chamaeleo
chamaeleon) provides insights on the evolution and diversification of sex chromosomes
in Chamaeleonidae. Zoology 141: 125738. https://doi.org/10.1016/j.zool.2019.125738

Sumner AT (1972) A simple technique for demonstrating centromeric heterochromatin. Exper-
imental Cell Research 75(1): 304-306. https://doi.org/10.1016/0014-4827(72)90558-7

Vences M, Glaw F (2005) A new species of Mantidactylus from the East Coast of Madagascar
and its molecular phylogenetic relationships within the subgenus Guibemantis. Herpeto-
logical Journal 15(1): 37-44.

Vences M, Glaw FE, Mausfeld P, Bohme W (1998) Comparative osteology of Malagasy poi-
son frogs of the genus Mantella (Amphibia: Ranidae: Mantellinae). Bonner zoologische
Beitrage 48: 205-215. https://www.biodiversitylibrary.org/page/44945242#page/221/
mode/1up

Vences M, Thomas M, van der Meijden A, Chiari Y, Vieites DR (2005) Comparative perfor-
mance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology
2(1): 5. https://doi.org/10.1186/1742-9994-2-5

Vences M, Wahl-Boos G, Hoegg S, Glaw F, Spinelli Oliveira E, Meyer A, Perry S (2007)
Molecular systematics of mantelline frogs from Madagascar and the evolution of their
femoral glands. Biological Journal of the Linnean Society 92(3): 529-539. https://doi.
org/10.1111/j.1095-8312.2007.00859.x

Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Madagascar as a model region of
species diversification. Trends in Ecology and Evolution 24(8): 456-465. https://doi.
org/10.1016/j.tree.2009.03.011

Vieites DR, Wollenberg KC, Andreone F, Kohler J, Glaw F, Vences M (2009) Vast underes-
timation of Madagascar’s biodiversity evidenced by an integrative amphibian inventory.
Proceedings of the National Academy of Sciences of the United States of America 106(20):
8267-8272. https://doi.org/10.1073/pnas.0810821106

Wollenberg KC, Vieites DR, Glaw FE, Vences M (2011) Speciation in little: the role of range and
body size in the diversification of Malagasy mantellid frogs. BMC Evolutionary Biology
11(1): 217. https://doi.org/10.1186/1471-2148-11-217

Zalesna A, Florek M, Rybacki M, Ogielska M (2017) Variability of NOR patterns in European
water frogs of different genome composition and ploidy level. Comparative Cytogenetics

11(2): 249-266. https://doi.org/10.3897/CompCytogen.v1 1i2.10804

ORCID

Marcello Mezzasalma https://orcid.org/0000-0002-7246-983 1
Franco Andreone https://orcid.org/0000-0001-9809-5818
Fabio Maria Guarino https://orcid.org/0000-0002-1511-7792
Angelica Crottini https://orcid.org/0000-0002-8505-3050